Mutagenetix > Incidental Mutation

Incidental Mutation 'R6494:Prph2'

522981

Institutional Source

Beutler Lab

Gene Symbol

Prph2

Ensembl Gene

ENSMUSG00000023978

Gene Name

peripherin 2

Synonyms

Nmf193, Rd2, rds, Tspan22

MMRRC Submission

044626-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6494 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46910459-46924933 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46911081 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 129 (T129A)

Ref Sequence

ENSEMBL: ENSMUSP00000024773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024773]

AlphaFold

P15499

Predicted Effect

probably benign
Transcript: ENSMUST00000024773
AA Change: T129A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000024773
Gene: ENSMUSG00000023978
AA Change: T129A

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	16	288	2.2e-28	PFAM
low complexity region	333	346	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162469

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 97.8%
20x: 92.4%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It may function as an adhesion molecule involved in stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. This protein is essential for disk morphogenesis. Defects in this gene are associated with both central and peripheral retinal degenerations. Some of the various phenotypically different disorders are autosomal dominant retinitis pigmentosa, progressive macular degeneration, macular dystrophy and retinitis pigmentosa digenic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation display slow retinal degeneration with thinning and loss of the outer nuclear layer, loss of photoreceptor outer segments, and increased numbers of Muller cells. Heterozygous mice also display retinal degeneration and Muller cell gliosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,971,924 (GRCm38)	N419S	possibly damaging	Het
Akt2	T	C	7: 27,616,349 (GRCm38)	L52P	possibly damaging	Het
Chd1l	G	A	3: 97,587,167 (GRCm38)	A399V	probably damaging	Het
Chic2	T	C	5: 75,044,282 (GRCm38)	E6G	probably benign	Het
Clca4a	T	A	3: 144,957,298 (GRCm38)	T597S	probably benign	Het
Col5a2	C	A	1: 45,378,327 (GRCm38)	D1363Y	probably damaging	Het
Csmd1	C	T	8: 16,211,695 (GRCm38)		probably null	Het
Dnah7b	A	T	1: 46,099,431 (GRCm38)	Y211F	probably damaging	Het
Efcab3	A	T	11: 105,100,019 (GRCm38)	Y5460F	possibly damaging	Het
Efcab6	T	A	15: 84,044,322 (GRCm38)		probably null	Het
Eno4	T	A	19: 58,962,794 (GRCm38)	Y237N	probably damaging	Het
Fer1l4	T	A	2: 156,045,470 (GRCm38)	D602V	probably benign	Het
Fgfr2	T	C	7: 130,198,550 (GRCm38)	N337S	probably damaging	Het
Fras1	C	T	5: 96,759,564 (GRCm38)	R3203C	possibly damaging	Het
Gbp2	T	A	3: 142,632,008 (GRCm38)	V295E	probably damaging	Het
Gm10549	C	A	18: 33,464,305 (GRCm38)		probably benign	Het
Hyal4	A	G	6: 24,765,746 (GRCm38)	I366M	possibly damaging	Het
Itsn2	C	T	12: 4,634,792 (GRCm38)	R448*	probably null	Het
Klhl35	G	T	7: 99,472,899 (GRCm38)	W69L	probably damaging	Het
Kpnb1	T	C	11: 97,181,648 (GRCm38)	I154V	probably benign	Het
Lax1	T	A	1: 133,680,448 (GRCm38)	Y185F	probably damaging	Het
Mmp12	C	T	9: 7,353,479 (GRCm38)	P208L	probably damaging	Het
Ndufb8	C	T	19: 44,555,305 (GRCm38)	V33M	probably null	Het
Nptn	T	G	9: 58,623,752 (GRCm38)	C169G	probably damaging	Het
Nuggc	A	T	14: 65,648,222 (GRCm38)	E766V	probably damaging	Het
Olfr1117-ps1	A	T	2: 87,309,176 (GRCm38)	N149I	possibly damaging	Het
Olfr1150-ps1	A	T	2: 87,357,632 (GRCm38)	K63*	probably null	Het
Pcdhga6	T	A	18: 37,708,541 (GRCm38)	I438N	probably damaging	Het
Pkn2	T	C	3: 142,803,668 (GRCm38)	N721S	possibly damaging	Het
Pole	T	C	5: 110,324,722 (GRCm38)	W1590R	possibly damaging	Het
Ptpro	A	T	6: 137,382,642 (GRCm38)	K403N	probably benign	Het
Rbck1	T	C	2: 152,330,966 (GRCm38)	D54G	possibly damaging	Het
Serpinb7	T	A	1: 107,435,346 (GRCm38)	L80*	probably null	Het
Setdb2	T	A	14: 59,402,414 (GRCm38)	Y676F	probably benign	Het
Skint1	G	T	4: 112,010,712 (GRCm38)	C12F	probably benign	Het
Slc22a26	T	A	19: 7,802,286 (GRCm38)	D55V	probably damaging	Het
Slc9a8	G	A	2: 167,424,291 (GRCm38)	V63I	probably damaging	Het
Sox2	T	A	3: 34,651,097 (GRCm38)	S228T	probably benign	Het
Spg11	A	G	2: 122,113,225 (GRCm38)	S149P	probably damaging	Het
Tbc1d19	T	A	5: 53,829,383 (GRCm38)	S45T	probably benign	Het
Tsacc	T	C	3: 88,295,396 (GRCm38)	E11G	probably benign	Het
Ttc7b	C	T	12: 100,495,407 (GRCm38)	A104T	possibly damaging	Het
Uox	C	T	3: 146,624,577 (GRCm38)	R163*	probably null	Het
Zfp108	T	A	7: 24,261,357 (GRCm38)	F458I	probably damaging	Het
Zfp616	A	T	11: 74,085,192 (GRCm38)	K762N	probably damaging	Het

Other mutations in Prph2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Prph2	APN	17	46,919,778 (GRCm38)	missense	probably damaging	0.97
IGL01087:Prph2	APN	17	46,911,159 (GRCm38)	missense	probably damaging	0.97
PIT4480001:Prph2	UTSW	17	46,911,113 (GRCm38)	frame shift	probably null
R0025:Prph2	UTSW	17	46,919,771 (GRCm38)	missense	probably benign	0.17
R2235:Prph2	UTSW	17	46,911,166 (GRCm38)	missense	probably damaging	1.00
R3120:Prph2	UTSW	17	46,923,372 (GRCm38)	missense	possibly damaging	0.49
R3954:Prph2	UTSW	17	46,910,718 (GRCm38)	missense	probably benign	0.39
R4864:Prph2	UTSW	17	46,910,922 (GRCm38)	missense	probably benign	0.03
R4972:Prph2	UTSW	17	46,910,807 (GRCm38)	missense	possibly damaging	0.94
R5645:Prph2	UTSW	17	46,910,667 (GRCm38)	start gained	probably benign
R5687:Prph2	UTSW	17	46,923,465 (GRCm38)	missense	probably damaging	0.99
R6658:Prph2	UTSW	17	46,919,864 (GRCm38)	missense	probably benign	0.05
R7775:Prph2	UTSW	17	46,910,806 (GRCm38)	missense	possibly damaging	0.82
R7778:Prph2	UTSW	17	46,910,806 (GRCm38)	missense	possibly damaging	0.82
R7824:Prph2	UTSW	17	46,910,806 (GRCm38)	missense	possibly damaging	0.82
R8098:Prph2	UTSW	17	46,919,966 (GRCm38)	missense	probably benign	0.09
R9221:Prph2	UTSW	17	46,919,892 (GRCm38)	missense	probably damaging	1.00
R9703:Prph2	UTSW	17	46,923,521 (GRCm38)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTCTGAGAGCCACTTTGTGC -3'
(R):5'- GAAGTCCAGGTAGCGATTGC -3'

Sequencing Primer
(F):5'- TGTGCCCAACTCCCTGATAGG -3'
(R):5'- GATTGCTGATCCACTGAATCTCGAAC -3'

Posted On

2018-06-06