Incidental Mutation 'R6494:Pcdhga6'
ID522983
Institutional Source Beutler Lab
Gene Symbol Pcdhga6
Ensembl Gene ENSMUSG00000103793
Gene Nameprotocadherin gamma subfamily A, 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6494 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37707039-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37708541 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 438 (I438N)
Ref Sequence ENSEMBL: ENSMUSP00000141803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112] [ENSMUST00000195823]
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157868
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195823
AA Change: I438N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793
AA Change: I438N

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc22a26 T A 19: 7,802,286 D55V probably damaging Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Pcdhga6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3551:Pcdhga6 UTSW 18 37708217 missense probably benign 0.42
R3552:Pcdhga6 UTSW 18 37708217 missense probably benign 0.42
R3688:Pcdhga6 UTSW 18 37708541 missense probably damaging 1.00
R3713:Pcdhga6 UTSW 18 37707923 missense probably damaging 0.99
R3832:Pcdhga6 UTSW 18 37708426 missense probably damaging 1.00
R3833:Pcdhga6 UTSW 18 37708426 missense probably damaging 1.00
R4607:Pcdhga6 UTSW 18 37708618 missense probably damaging 1.00
R5594:Pcdhga6 UTSW 18 37708528 missense probably benign 0.40
R5608:Pcdhga6 UTSW 18 37707461 missense possibly damaging 0.50
R5887:Pcdhga6 UTSW 18 37708559 missense probably damaging 1.00
R6188:Pcdhga6 UTSW 18 37708271 missense probably benign 0.00
R6276:Pcdhga6 UTSW 18 37707644 missense probably benign 0.28
R6619:Pcdhga6 UTSW 18 37709649 missense probably benign 0.00
R7145:Pcdhga6 UTSW 18 37707728 missense probably damaging 0.99
R7211:Pcdhga6 UTSW 18 37709120 missense probably benign 0.01
R7313:Pcdhga6 UTSW 18 37708019 missense possibly damaging 0.60
R7425:Pcdhga6 UTSW 18 37708566 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAATGGCCTGGTAATATGC -3'
(R):5'- ACCAGTGATGGAGTTGATGG -3'

Sequencing Primer
(F):5'- GGCCTGGTAATATGCTCCATATCAG -3'
(R):5'- GGATAGAGGTGTTCCCTGAAG -3'
Posted On2018-06-06