Incidental Mutation 'R6494:Slc22a26'
ID522985
Institutional Source Beutler Lab
Gene Symbol Slc22a26
Ensembl Gene ENSMUSG00000053303
Gene Namesolute carrier family 22 (organic cation transporter), member 26
SynonymsBC014805
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6494 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location7781041-7802667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7802286 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 55 (D55V)
Ref Sequence ENSEMBL: ENSMUSP00000113607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065634] [ENSMUST00000120522]
Predicted Effect probably damaging
Transcript: ENSMUST00000065634
AA Change: D55V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064809
Gene: ENSMUSG00000053303
AA Change: D55V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 96 528 1.1e-23 PFAM
Pfam:MFS_1 124 370 7.8e-17 PFAM
Pfam:MFS_1 350 547 2.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120522
AA Change: D55V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113607
Gene: ENSMUSG00000053303
AA Change: D55V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 94 527 4.9e-23 PFAM
Pfam:MFS_1 124 358 1.2e-15 PFAM
Pfam:MFS_1 349 547 2.4e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.4%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,924 N419S possibly damaging Het
Akt2 T C 7: 27,616,349 L52P possibly damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chic2 T C 5: 75,044,282 E6G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Col5a2 C A 1: 45,378,327 D1363Y probably damaging Het
Csmd1 C T 8: 16,211,695 probably null Het
Dnah7b A T 1: 46,099,431 Y211F probably damaging Het
Efcab3 A T 11: 105,100,019 Y5460F possibly damaging Het
Efcab6 T A 15: 84,044,322 probably null Het
Eno4 T A 19: 58,962,794 Y237N probably damaging Het
Fer1l4 T A 2: 156,045,470 D602V probably benign Het
Fgfr2 T C 7: 130,198,550 N337S probably damaging Het
Fras1 C T 5: 96,759,564 R3203C possibly damaging Het
Gbp2 T A 3: 142,632,008 V295E probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hyal4 A G 6: 24,765,746 I366M possibly damaging Het
Itsn2 C T 12: 4,634,792 R448* probably null Het
Klhl35 G T 7: 99,472,899 W69L probably damaging Het
Kpnb1 T C 11: 97,181,648 I154V probably benign Het
Lax1 T A 1: 133,680,448 Y185F probably damaging Het
Mmp12 C T 9: 7,353,479 P208L probably damaging Het
Ndufb8 C T 19: 44,555,305 V33M probably null Het
Nptn T G 9: 58,623,752 C169G probably damaging Het
Nuggc A T 14: 65,648,222 E766V probably damaging Het
Olfr1117-ps1 A T 2: 87,309,176 N149I possibly damaging Het
Olfr1150-ps1 A T 2: 87,357,632 K63* probably null Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pkn2 T C 3: 142,803,668 N721S possibly damaging Het
Pole T C 5: 110,324,722 W1590R possibly damaging Het
Prph2 A G 17: 46,911,081 T129A probably benign Het
Ptpro A T 6: 137,382,642 K403N probably benign Het
Rbck1 T C 2: 152,330,966 D54G possibly damaging Het
Serpinb7 T A 1: 107,435,346 L80* probably null Het
Setdb2 T A 14: 59,402,414 Y676F probably benign Het
Skint1 G T 4: 112,010,712 C12F probably benign Het
Slc9a8 G A 2: 167,424,291 V63I probably damaging Het
Sox2 T A 3: 34,651,097 S228T probably benign Het
Spg11 A G 2: 122,113,225 S149P probably damaging Het
Tbc1d19 T A 5: 53,829,383 S45T probably benign Het
Tsacc T C 3: 88,295,396 E11G probably benign Het
Ttc7b C T 12: 100,495,407 A104T possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Zfp108 T A 7: 24,261,357 F458I probably damaging Het
Zfp616 A T 11: 74,085,192 K762N probably damaging Het
Other mutations in Slc22a26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a26 APN 19 7782836 missense probably damaging 0.99
IGL00338:Slc22a26 APN 19 7782975 missense probably benign 0.25
IGL00736:Slc22a26 APN 19 7790162 missense possibly damaging 0.50
IGL01085:Slc22a26 APN 19 7790099 missense probably benign 0.02
IGL01581:Slc22a26 APN 19 7802184 missense probably benign 0.15
IGL02502:Slc22a26 APN 19 7790760 critical splice donor site probably null
IGL02658:Slc22a26 APN 19 7788248 missense probably benign 0.25
IGL02936:Slc22a26 APN 19 7791105 missense probably damaging 0.99
IGL03162:Slc22a26 APN 19 7802101 missense probably benign 0.00
R0034:Slc22a26 UTSW 19 7802253 missense probably benign 0.03
R0633:Slc22a26 UTSW 19 7788210 critical splice donor site probably null
R0676:Slc22a26 UTSW 19 7796144 splice site probably benign
R2156:Slc22a26 UTSW 19 7802115 missense probably damaging 1.00
R4043:Slc22a26 UTSW 19 7788329 critical splice acceptor site probably null
R4781:Slc22a26 UTSW 19 7790135 missense probably benign 0.34
R4896:Slc22a26 UTSW 19 7791054 missense probably benign 0.14
R4999:Slc22a26 UTSW 19 7802181 missense probably damaging 1.00
R5125:Slc22a26 UTSW 19 7790175 missense possibly damaging 0.62
R5178:Slc22a26 UTSW 19 7790175 missense possibly damaging 0.62
R6161:Slc22a26 UTSW 19 7786447 missense possibly damaging 0.50
R6512:Slc22a26 UTSW 19 7802500 start gained probably benign
R6724:Slc22a26 UTSW 19 7802361 missense probably benign 0.14
R7323:Slc22a26 UTSW 19 7790894 missense probably damaging 0.97
R7375:Slc22a26 UTSW 19 7783144 intron probably null
R7558:Slc22a26 UTSW 19 7785286 missense possibly damaging 0.94
R7634:Slc22a26 UTSW 19 7802587 utr 5 prime probably null
Predicted Primers PCR Primer
(F):5'- AGAAAAGTCCTCTGGTCATACAC -3'
(R):5'- GGCAGTCATTCAGCCTCAATG -3'

Sequencing Primer
(F):5'- AGCCATCCATACAGGGCTCTG -3'
(R):5'- AATGGCCTTTCAGGATCTTCTG -3'
Posted On2018-06-06