Incidental Mutation 'R6492:Itfg1'
ID522986
Institutional Source Beutler Lab
Gene Symbol Itfg1
Ensembl Gene ENSMUSG00000031703
Gene Nameintegrin alpha FG-GAP repeat containing 1
SynonymsD8Wsu49e, 2310047C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6492 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85717578-85840921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85740349 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 365 (V365A)
Ref Sequence ENSEMBL: ENSMUSP00000034140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034140]
Predicted Effect probably benign
Transcript: ENSMUST00000034140
AA Change: V365A

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703
AA Change: V365A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCOP:d1m1xa4 46 232 5e-3 SMART
low complexity region 482 496 N/A INTRINSIC
transmembrane domain 564 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210912
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,654,505 T587I probably benign Het
Abl1 T A 2: 31,801,655 M1062K probably benign Het
Agbl4 G A 4: 111,547,272 D272N probably damaging Het
Apob A T 12: 8,008,261 I2215F probably damaging Het
Atp10b A T 11: 43,218,957 Q821H probably damaging Het
Atp1a3 T C 7: 24,979,304 Y971C probably damaging Het
Atp6ap1l A T 13: 90,883,722 H280Q probably damaging Het
B4galt2 A T 4: 117,876,967 M291K probably damaging Het
Cachd1 G T 4: 100,952,118 V267F possibly damaging Het
Cadm2 G T 16: 66,784,828 L188M probably damaging Het
Ceacam19 T C 7: 19,882,592 N199S probably benign Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clca4a T A 3: 144,957,298 T597S probably benign Het
Cluap1 T A 16: 3,928,612 M279K probably benign Het
Cngb1 T A 8: 95,264,424 M717L probably benign Het
Cp T C 3: 19,982,022 V777A probably benign Het
Drosha A G 15: 12,861,706 D594G probably benign Het
Exo5 A G 4: 120,921,537 probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gprc5b A G 7: 118,984,577 I23T possibly damaging Het
Ikbke T C 1: 131,259,218 Y579C probably damaging Het
Ikzf2 T C 1: 69,539,042 Y362C probably damaging Het
Josd2 T C 7: 44,471,154 I105T probably damaging Het
Mc3r G A 2: 172,249,154 A99T possibly damaging Het
Mettl22 T A 16: 8,488,891 probably null Het
Mgat5 A G 1: 127,471,564 I619V probably benign Het
Nin T C 12: 70,054,534 I430V probably benign Het
Olfr1047 T A 2: 86,228,387 I195F possibly damaging Het
Olfr1052 T C 2: 86,298,646 F277L probably benign Het
Olfr153 C G 2: 87,532,741 A236G possibly damaging Het
Olfr221 A G 14: 52,035,445 F222S probably benign Het
Olfr668 C A 7: 104,925,645 A40S possibly damaging Het
Parvb T C 15: 84,303,872 L272P probably damaging Het
Pde2a A G 7: 101,500,442 K180E possibly damaging Het
Pik3c3 C T 18: 30,324,562 T736M probably damaging Het
Plcb4 C T 2: 135,973,071 R760* probably null Het
Pramel6 C T 2: 87,510,422 T366I probably benign Het
Prr29 C T 11: 106,375,236 R42W probably damaging Het
Prss12 A G 3: 123,447,399 I81V probably benign Het
Ptpn13 A G 5: 103,501,612 T294A probably benign Het
Ptprc A T 1: 138,113,562 probably null Het
Sin3b T A 8: 72,733,490 probably null Het
Slco5a1 T C 1: 12,989,927 Y190C probably damaging Het
Slco6c1 T G 1: 97,125,813 Y121S probably damaging Het
Srcap G T 7: 127,522,145 G217* probably null Het
Ss18 A T 18: 14,651,088 M181K probably damaging Het
Synm T C 7: 67,736,061 T176A probably benign Het
Taf3 T C 2: 9,951,160 E579G probably damaging Het
Taf7 A G 18: 37,643,106 I136T probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Tyrp1 A G 4: 80,840,781 D297G probably null Het
Uox C T 3: 146,624,577 R163* probably null Het
Wisp3 C T 10: 39,154,987 G180D probably benign Het
Wwp1 G A 4: 19,650,299 S289L possibly damaging Het
Xbp1 T C 11: 5,521,005 V4A probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb2 T C 10: 4,369,711 Y105C probably damaging Het
Zeb2 T C 2: 45,110,496 probably benign Het
Zkscan8 A T 13: 21,525,227 I167N probably benign Het
Other mutations in Itfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Itfg1 APN 8 85780565 missense possibly damaging 0.95
IGL02803:Itfg1 APN 8 85725511 splice site probably null
R0368:Itfg1 UTSW 8 85764407 missense probably damaging 1.00
R0755:Itfg1 UTSW 8 85726205 missense possibly damaging 0.90
R1183:Itfg1 UTSW 8 85780523 missense probably benign 0.04
R1529:Itfg1 UTSW 8 85810614 missense probably benign 0.02
R1789:Itfg1 UTSW 8 85725512 critical splice donor site probably null
R1953:Itfg1 UTSW 8 85831231 missense probably benign 0.31
R2206:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2207:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2260:Itfg1 UTSW 8 85722677 missense probably damaging 1.00
R2358:Itfg1 UTSW 8 85738129 missense probably damaging 1.00
R2876:Itfg1 UTSW 8 85780510 splice site probably benign
R2990:Itfg1 UTSW 8 85835049 missense possibly damaging 0.82
R4484:Itfg1 UTSW 8 85726249 missense probably damaging 1.00
R4762:Itfg1 UTSW 8 85732441 missense possibly damaging 0.95
R5146:Itfg1 UTSW 8 85718868 makesense probably null
R5796:Itfg1 UTSW 8 85718893 missense probably damaging 1.00
R5805:Itfg1 UTSW 8 85766972 missense probably benign 0.04
R6084:Itfg1 UTSW 8 85726170 missense probably benign 0.01
R6187:Itfg1 UTSW 8 85836465 missense probably damaging 1.00
R6319:Itfg1 UTSW 8 85840629 missense probably damaging 1.00
R6463:Itfg1 UTSW 8 85736151 missense probably benign 0.03
R6490:Itfg1 UTSW 8 85740301 missense probably benign 0.08
R6588:Itfg1 UTSW 8 85736130 missense probably benign
R6753:Itfg1 UTSW 8 85835078 missense probably benign 0.04
R7489:Itfg1 UTSW 8 85767001 missense probably damaging 1.00
R7665:Itfg1 UTSW 8 85764350 missense probably benign
R7912:Itfg1 UTSW 8 85764280 missense probably damaging 1.00
R7985:Itfg1 UTSW 8 85725568 missense probably damaging 1.00
X0067:Itfg1 UTSW 8 85840753 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CATGAAGCTACAGTGAGACGAGA -3'
(R):5'- TCAATAACTTAAAGCGCAAGGC -3'

Sequencing Primer
(F):5'- GGCAACTATGGCGTCTTT -3'
(R):5'- GAAGGATGGACATAGAAACTCAAC -3'
Posted On2018-06-06