Incidental Mutation 'R6496:Atp8b5'
ID523011
Institutional Source Beutler Lab
Gene Symbol Atp8b5
Ensembl Gene ENSMUSG00000028457
Gene NameATPase, class I, type 8B, member 5
Synonyms4930417M19Rik, FetA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6496 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43267159-43373833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43371003 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1047 (F1047L)
Ref Sequence ENSEMBL: ENSMUSP00000103575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107937] [ENSMUST00000107942]
Predicted Effect probably benign
Transcript: ENSMUST00000107937
Predicted Effect probably benign
Transcript: ENSMUST00000107942
AA Change: F1047L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457
AA Change: F1047L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Meta Mutation Damage Score 0.1016 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,540,406 T79S probably benign Het
4930430A15Rik T A 2: 111,164,472 H232L unknown Het
Atp2b1 T A 10: 99,003,337 C676S probably damaging Het
B3gnt4 G A 5: 123,511,591 E340K probably benign Het
Casp8ap2 A C 4: 32,641,553 H869P probably benign Het
Cdh26 G A 2: 178,449,861 G71D probably damaging Het
Col4a2 G T 8: 11,402,993 G187* probably null Het
Col4a2 G T 8: 11,402,994 G187V probably damaging Het
Dsn1 A G 2: 157,005,267 S84P probably damaging Het
Edaradd T A 13: 12,478,442 D123V probably damaging Het
Epb41l1 T C 2: 156,533,796 S611P possibly damaging Het
Fam205a1 G T 4: 42,848,424 T1244K probably damaging Het
Fam217a G A 13: 34,910,802 R234* probably null Het
Gm17175 A G 14: 51,573,077 I31T probably benign Het
Jtb T C 3: 90,233,957 V80A possibly damaging Het
Kera T A 10: 97,612,810 N297K probably benign Het
Klhl1 T C 14: 96,240,216 N472S probably benign Het
Lgmn T C 12: 102,398,239 T324A probably benign Het
Ndst3 A G 3: 123,552,552 I276T probably damaging Het
Nsd2 A G 5: 33,843,513 K125E probably damaging Het
Olfr1129 A C 2: 87,575,116 N11H probably damaging Het
Olfr820 T A 10: 130,017,579 S73T probably benign Het
Patj C A 4: 98,416,752 A281E probably damaging Het
Pcdha7 A G 18: 36,974,585 E221G possibly damaging Het
Plcd1 A G 9: 119,072,641 F605S possibly damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Pmfbp1 A G 8: 109,532,157 K698R probably null Het
Psd G A 19: 46,320,314 R628C probably damaging Het
Sipa1l2 T C 8: 125,449,894 N1211S probably benign Het
Slc1a3 T A 15: 8,649,581 M177L probably benign Het
Slc34a1 T C 13: 55,402,682 S183P probably benign Het
Spata22 G A 11: 73,340,363 G148R probably damaging Het
Tfap2a T C 13: 40,728,775 D18G probably damaging Het
Thoc7 T C 14: 13,954,593 N28S possibly damaging Het
Usp42 T C 5: 143,715,103 Y1055C probably damaging Het
Zfp874a A G 13: 67,442,575 V330A possibly damaging Het
Other mutations in Atp8b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Atp8b5 APN 4 43355567 missense probably damaging 1.00
IGL00970:Atp8b5 APN 4 43311938 missense probably benign 0.01
IGL01335:Atp8b5 APN 4 43302628 missense possibly damaging 0.90
IGL01462:Atp8b5 APN 4 43368010 missense possibly damaging 0.90
IGL01657:Atp8b5 APN 4 43291693 missense probably benign 0.04
IGL01935:Atp8b5 APN 4 43366638 missense probably benign 0.03
IGL01977:Atp8b5 APN 4 43320590 critical splice acceptor site probably null
IGL02102:Atp8b5 APN 4 43364167 missense probably benign 0.10
IGL02369:Atp8b5 APN 4 43334205 missense probably benign
IGL02456:Atp8b5 APN 4 43365578 missense probably benign 0.16
IGL02696:Atp8b5 APN 4 43369634 missense possibly damaging 0.61
IGL02826:Atp8b5 APN 4 43366770 missense probably damaging 1.00
IGL02947:Atp8b5 APN 4 43305774 missense possibly damaging 0.49
R0128:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0130:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0243:Atp8b5 UTSW 4 43366057 missense probably benign
R0256:Atp8b5 UTSW 4 43302576 intron probably benign
R0379:Atp8b5 UTSW 4 43361898 missense probably damaging 0.99
R0671:Atp8b5 UTSW 4 43291672 missense possibly damaging 0.83
R1109:Atp8b5 UTSW 4 43305719 intron probably benign
R1442:Atp8b5 UTSW 4 43334313 missense probably damaging 0.99
R1454:Atp8b5 UTSW 4 43302590 missense probably benign
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1503:Atp8b5 UTSW 4 43344430 missense probably damaging 1.00
R1580:Atp8b5 UTSW 4 43355673 missense possibly damaging 0.49
R1677:Atp8b5 UTSW 4 43372903 missense possibly damaging 0.61
R1861:Atp8b5 UTSW 4 43372906 missense probably damaging 1.00
R1899:Atp8b5 UTSW 4 43361804 missense possibly damaging 0.47
R1903:Atp8b5 UTSW 4 43357063 missense probably damaging 0.98
R1961:Atp8b5 UTSW 4 43369688 missense probably damaging 0.98
R2131:Atp8b5 UTSW 4 43370726 missense probably benign 0.33
R2971:Atp8b5 UTSW 4 43361953 splice site probably benign
R3023:Atp8b5 UTSW 4 43311957 missense possibly damaging 0.82
R3433:Atp8b5 UTSW 4 43372697 missense probably benign
R3690:Atp8b5 UTSW 4 43368055 missense probably damaging 1.00
R4157:Atp8b5 UTSW 4 43365591 missense probably damaging 0.97
R4484:Atp8b5 UTSW 4 43357016 missense probably damaging 1.00
R4510:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4511:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4679:Atp8b5 UTSW 4 43365955 missense probably benign 0.16
R4753:Atp8b5 UTSW 4 43372710 missense probably damaging 1.00
R4761:Atp8b5 UTSW 4 43308504 makesense probably null
R4784:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4785:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4855:Atp8b5 UTSW 4 43344449 missense probably benign
R5422:Atp8b5 UTSW 4 43366644 missense probably benign 0.10
R5915:Atp8b5 UTSW 4 43370577 missense probably damaging 1.00
R6228:Atp8b5 UTSW 4 43304674 missense probably damaging 1.00
R6708:Atp8b5 UTSW 4 43334249 missense probably benign
R6931:Atp8b5 UTSW 4 43364108 critical splice acceptor site probably null
R7021:Atp8b5 UTSW 4 43355618 missense probably damaging 0.99
R7085:Atp8b5 UTSW 4 43361835 missense probably damaging 1.00
R7207:Atp8b5 UTSW 4 43357018 missense probably damaging 0.97
R7404:Atp8b5 UTSW 4 43342640 missense probably benign 0.10
R7448:Atp8b5 UTSW 4 43366021 missense probably benign
R7465:Atp8b5 UTSW 4 43271269 missense probably benign 0.00
R7526:Atp8b5 UTSW 4 43366609 missense probably damaging 0.99
X0025:Atp8b5 UTSW 4 43366774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGACGACTCTGATTGGC -3'
(R):5'- CCTCTAAGCATCATGATGTAGAGTTTC -3'

Sequencing Primer
(F):5'- CGACTCTGATTGGCGTCATGAC -3'
(R):5'- TAGCATTCCACTAGTCCC -3'
Posted On2018-06-06