Incidental Mutation 'R6496:Lgmn'
ID 523033
Institutional Source Beutler Lab
Gene Symbol Lgmn
Ensembl Gene ENSMUSG00000021190
Gene Name legumain
Synonyms Prsc1, preprolegumain, AEP
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6496 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 102394084-102439813 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102398239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 324 (T324A)
Ref Sequence ENSEMBL: ENSMUSP00000105647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021607] [ENSMUST00000110020]
AlphaFold O89017
Predicted Effect probably benign
Transcript: ENSMUST00000021607
AA Change: T324A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021607
Gene: ENSMUSG00000021190
AA Change: T324A

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110020
AA Change: T324A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105647
Gene: ENSMUSG00000021190
AA Change: T324A

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146499
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes a member of the cysteine peptidase family C13 that plays an important role in the endosome/lysosomal degradation system. The encoded inactive preproprotein undergoes autocatalytic removal of the C-terminal inhibitory propeptide to generate the active endopeptidase that cleaves protein substrates on the C-terminal side of asparagine residues. Mice lacking the encoded protein exhibit defects in the lysosomal processing of proteins resulting in their accumulation in the lysosomes, and develop symptoms resembling hemophagocytic lymphohistiocytosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a null allele exhibit slow postnatal weight gain, develop features of hemophagocytic syndrome, and accumulate giant lysosomes in renal tubule cells. Homozygotes for another null allele display impaired TLR9 signaling in dendritic cells, progressive kidney pathology, and proteinuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,540,406 T79S probably benign Het
4930430A15Rik T A 2: 111,164,472 H232L unknown Het
Atp2b1 T A 10: 99,003,337 C676S probably damaging Het
Atp8b5 T C 4: 43,371,003 F1047L probably benign Het
B3gnt4 G A 5: 123,511,591 E340K probably benign Het
Casp8ap2 A C 4: 32,641,553 H869P probably benign Het
Cdh26 G A 2: 178,449,861 G71D probably damaging Het
Col4a2 G T 8: 11,402,993 G187* probably null Het
Col4a2 G T 8: 11,402,994 G187V probably damaging Het
Dsn1 A G 2: 157,005,267 S84P probably damaging Het
Edaradd T A 13: 12,478,442 D123V probably damaging Het
Epb41l1 T C 2: 156,533,796 S611P possibly damaging Het
Fam205a1 G T 4: 42,848,424 T1244K probably damaging Het
Fam217a G A 13: 34,910,802 R234* probably null Het
Gm17175 A G 14: 51,573,077 I31T probably benign Het
Jtb T C 3: 90,233,957 V80A possibly damaging Het
Kera T A 10: 97,612,810 N297K probably benign Het
Klhl1 T C 14: 96,240,216 N472S probably benign Het
Ndst3 A G 3: 123,552,552 I276T probably damaging Het
Nsd2 A G 5: 33,843,513 K125E probably damaging Het
Olfr1129 A C 2: 87,575,116 N11H probably damaging Het
Olfr820 T A 10: 130,017,579 S73T probably benign Het
Patj C A 4: 98,416,752 A281E probably damaging Het
Pcdha7 A G 18: 36,974,585 E221G possibly damaging Het
Plcd1 A G 9: 119,072,641 F605S possibly damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Pmfbp1 A G 8: 109,532,157 K698R probably null Het
Psd G A 19: 46,320,314 R628C probably damaging Het
Sipa1l2 T C 8: 125,449,894 N1211S probably benign Het
Slc1a3 T A 15: 8,649,581 M177L probably benign Het
Slc34a1 T C 13: 55,402,682 S183P probably benign Het
Spata22 G A 11: 73,340,363 G148R probably damaging Het
Tfap2a T C 13: 40,728,775 D18G probably damaging Het
Thoc7 T C 14: 13,954,593 N28S possibly damaging Het
Usp42 T C 5: 143,715,103 Y1055C probably damaging Het
Zfp874a A G 13: 67,442,575 V330A possibly damaging Het
Other mutations in Lgmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Lgmn APN 12 102398176 splice site probably benign
IGL02069:Lgmn APN 12 102404299 missense possibly damaging 0.92
IGL02150:Lgmn APN 12 102395727 missense possibly damaging 0.80
IGL02228:Lgmn APN 12 102395714 missense probably benign 0.04
IGL02637:Lgmn APN 12 102400226 missense probably damaging 0.98
Getz UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0988:Lgmn UTSW 12 102398277 missense probably damaging 0.99
R1451:Lgmn UTSW 12 102405892 splice site probably benign
R1568:Lgmn UTSW 12 102394609 missense possibly damaging 0.95
R1944:Lgmn UTSW 12 102401924 missense probably damaging 1.00
R1972:Lgmn UTSW 12 102395821 unclassified probably benign
R2133:Lgmn UTSW 12 102394908 missense probably damaging 1.00
R2298:Lgmn UTSW 12 102395678 missense probably damaging 0.99
R3846:Lgmn UTSW 12 102404329 missense possibly damaging 0.87
R4610:Lgmn UTSW 12 102400124 splice site probably benign
R4788:Lgmn UTSW 12 102402677 missense probably benign 0.11
R5050:Lgmn UTSW 12 102403421 splice site probably null
R5708:Lgmn UTSW 12 102404328 missense possibly damaging 0.87
R5969:Lgmn UTSW 12 102405827 missense probably damaging 1.00
R6090:Lgmn UTSW 12 102400154 missense probably damaging 1.00
R6420:Lgmn UTSW 12 102423719 nonsense probably null
R6592:Lgmn UTSW 12 102404270 missense probably damaging 1.00
R6659:Lgmn UTSW 12 102402692 missense probably benign 0.03
R7063:Lgmn UTSW 12 102402678 missense probably damaging 1.00
R7336:Lgmn UTSW 12 102423739 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGAGGCCATGCTCCTTTCTG -3'
(R):5'- TAGTTTCTCAGCAAACGTGTTG -3'

Sequencing Primer
(F):5'- TTCTGGATCTGGAGAGGAAGTACCC -3'
(R):5'- CTCAGCAAACGTGTTGAATTTG -3'
Posted On 2018-06-06