Incidental Mutation 'R6496:Fam217a'
ID523035
Institutional Source Beutler Lab
Gene Symbol Fam217a
Ensembl Gene ENSMUSG00000021414
Gene Namefamily with sequence similarity 217, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6496 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location34909960-34924310 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 34910802 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 234 (R234*)
Ref Sequence ENSEMBL: ENSMUSP00000153128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021851] [ENSMUST00000077853] [ENSMUST00000223834] [ENSMUST00000225242]
Predicted Effect probably null
Transcript: ENSMUST00000021851
AA Change: R325*
SMART Domains Protein: ENSMUSP00000021851
Gene: ENSMUSG00000021414
AA Change: R325*

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:FAM217 206 411 2e-54 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 444 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077853
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223228
Predicted Effect probably null
Transcript: ENSMUST00000223834
AA Change: R477*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224613
Predicted Effect probably null
Transcript: ENSMUST00000225242
AA Change: R234*
Meta Mutation Damage Score 0.9661 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.7%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T A 2: 19,540,406 T79S probably benign Het
4930430A15Rik T A 2: 111,164,472 H232L unknown Het
Atp2b1 T A 10: 99,003,337 C676S probably damaging Het
Atp8b5 T C 4: 43,371,003 F1047L probably benign Het
B3gnt4 G A 5: 123,511,591 E340K probably benign Het
Casp8ap2 A C 4: 32,641,553 H869P probably benign Het
Cdh26 G A 2: 178,449,861 G71D probably damaging Het
Col4a2 G T 8: 11,402,993 G187* probably null Het
Col4a2 G T 8: 11,402,994 G187V probably damaging Het
Dsn1 A G 2: 157,005,267 S84P probably damaging Het
Edaradd T A 13: 12,478,442 D123V probably damaging Het
Epb41l1 T C 2: 156,533,796 S611P possibly damaging Het
Fam205a1 G T 4: 42,848,424 T1244K probably damaging Het
Gm17175 A G 14: 51,573,077 I31T probably benign Het
Jtb T C 3: 90,233,957 V80A possibly damaging Het
Kera T A 10: 97,612,810 N297K probably benign Het
Klhl1 T C 14: 96,240,216 N472S probably benign Het
Lgmn T C 12: 102,398,239 T324A probably benign Het
Ndst3 A G 3: 123,552,552 I276T probably damaging Het
Nsd2 A G 5: 33,843,513 K125E probably damaging Het
Olfr1129 A C 2: 87,575,116 N11H probably damaging Het
Olfr820 T A 10: 130,017,579 S73T probably benign Het
Patj C A 4: 98,416,752 A281E probably damaging Het
Pcdha7 A G 18: 36,974,585 E221G possibly damaging Het
Plcd1 A G 9: 119,072,641 F605S possibly damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Pmfbp1 A G 8: 109,532,157 K698R probably null Het
Psd G A 19: 46,320,314 R628C probably damaging Het
Sipa1l2 T C 8: 125,449,894 N1211S probably benign Het
Slc1a3 T A 15: 8,649,581 M177L probably benign Het
Slc34a1 T C 13: 55,402,682 S183P probably benign Het
Spata22 G A 11: 73,340,363 G148R probably damaging Het
Tfap2a T C 13: 40,728,775 D18G probably damaging Het
Thoc7 T C 14: 13,954,593 N28S possibly damaging Het
Usp42 T C 5: 143,715,103 Y1055C probably damaging Het
Zfp874a A G 13: 67,442,575 V330A possibly damaging Het
Other mutations in Fam217a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Fam217a APN 13 34915649 splice site probably benign
IGL02222:Fam217a APN 13 34911119 missense probably damaging 1.00
IGL02302:Fam217a APN 13 34911161 missense probably damaging 1.00
IGL02371:Fam217a APN 13 34911401 missense possibly damaging 0.53
IGL02538:Fam217a APN 13 34911113 missense probably damaging 0.98
R0324:Fam217a UTSW 13 34910961 missense possibly damaging 0.71
R0616:Fam217a UTSW 13 34913683 missense probably benign 0.03
R1497:Fam217a UTSW 13 34911212 missense probably damaging 0.97
R1934:Fam217a UTSW 13 34910881 missense probably damaging 1.00
R1981:Fam217a UTSW 13 34916754 missense probably benign 0.07
R2133:Fam217a UTSW 13 34913680 missense probably damaging 1.00
R2344:Fam217a UTSW 13 34910335 missense probably damaging 1.00
R4182:Fam217a UTSW 13 34910256 missense possibly damaging 0.75
R4601:Fam217a UTSW 13 34911302 missense probably damaging 1.00
R4909:Fam217a UTSW 13 34910406 missense probably damaging 1.00
R5583:Fam217a UTSW 13 34910297 missense probably damaging 1.00
R6027:Fam217a UTSW 13 34910994 missense possibly damaging 0.77
R7166:Fam217a UTSW 13 34910315 missense probably benign 0.07
R7394:Fam217a UTSW 13 34910279 missense possibly damaging 0.73
R7710:Fam217a UTSW 13 34911128 missense possibly damaging 0.92
R8409:Fam217a UTSW 13 34916898 missense probably benign
R8716:Fam217a UTSW 13 34924265 start gained probably benign
R8782:Fam217a UTSW 13 34911050 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTTGCCAGCACTGCTCAAG -3'
(R):5'- CCAAGTGCCTGTATATGCCG -3'

Sequencing Primer
(F):5'- TGCTCAAGCTCCATTTGGAAAC -3'
(R):5'- ACTCTGGACCTACACAGATTTG -3'
Posted On2018-06-06