Incidental Mutation 'R6497:Gm14393'
ID523051
Institutional Source Beutler Lab
Gene Symbol Gm14393
Ensembl Gene ENSMUSG00000078905
Gene Namepredicted gene 14393
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6497 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location175061549-175067781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 175061634 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 160 (E160G)
Ref Sequence ENSEMBL: ENSMUSP00000072668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072895] [ENSMUST00000109066]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072895
AA Change: E160G

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072668
Gene: ENSMUSG00000078905
AA Change: E160G

DomainStartEndE-ValueType
KRAB 4 66 9.34e-15 SMART
ZnF_C2H2 103 125 8.47e-4 SMART
ZnF_C2H2 131 153 9.22e-5 SMART
ZnF_C2H2 159 181 1.03e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109066
SMART Domains Protein: ENSMUSP00000104694
Gene: ENSMUSG00000078905

DomainStartEndE-ValueType
KRAB 4 64 1.21e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122320
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,805,105 Y399N probably damaging Het
Acsm3 G A 7: 119,780,749 probably null Het
Aldh16a1 T A 7: 45,144,937 S556C possibly damaging Het
Armc7 T C 11: 115,476,251 I74T probably benign Het
Atp13a4 T C 16: 29,479,901 D80G probably damaging Het
Bicral A T 17: 46,825,573 I237K probably damaging Het
Caskin1 T C 17: 24,504,548 V770A probably benign Het
Cd209c T C 8: 3,944,122 K113E possibly damaging Het
Cdh7 G A 1: 110,065,798 probably null Het
Clca3a1 A T 3: 144,759,259 V71D possibly damaging Het
Cntnap5a T C 1: 116,577,897 L1228P probably damaging Het
Cntrl A G 2: 35,135,572 N85D possibly damaging Het
Coch G A 12: 51,602,721 V272M probably benign Het
Col22a1 T C 15: 71,890,576 E78G possibly damaging Het
Cyp2c66 T A 19: 39,163,377 C179S probably damaging Het
Dsg3 A G 18: 20,537,248 I681V probably benign Het
Egflam A T 15: 7,251,303 probably null Het
Fut10 T A 8: 31,236,250 D344E probably damaging Het
Gad2 C T 2: 22,668,257 P329L probably damaging Het
Gprc6a T C 10: 51,615,701 I476V probably benign Het
Limk2 A G 11: 3,360,492 F71L probably benign Het
Neb A T 2: 52,258,289 N2648K possibly damaging Het
Olfr561 T A 7: 102,775,450 F309I probably benign Het
Olfr646 T C 7: 104,107,215 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhgb7 T A 18: 37,753,853 V692E probably damaging Het
Pclo A C 5: 14,793,855 K4802Q unknown Het
Primpol A T 8: 46,586,341 probably null Het
Prr14 C T 7: 127,474,578 R205C probably benign Het
Rbm12b1 T C 4: 12,146,431 I801T probably benign Het
Ror2 A T 13: 53,131,919 N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Skint6 A G 4: 113,236,398 Y183H probably damaging Het
Snapc3 G T 4: 83,453,126 E388* probably null Het
Srrm4 A T 5: 116,467,491 S236T unknown Het
Srrt G T 5: 137,297,506 P193H probably damaging Het
Sspo A T 6: 48,495,208 T810S possibly damaging Het
Stk36 A G 1: 74,603,232 H6R probably damaging Het
Tiam2 A G 17: 3,506,827 T1181A probably damaging Het
Tmem184a A G 5: 139,813,000 F65L probably damaging Het
Vwa8 A G 14: 79,096,401 I1330M probably benign Het
Zfp827 T A 8: 79,180,128 M923K probably damaging Het
Other mutations in Gm14393
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02873:Gm14393 APN 2 175061802 missense possibly damaging 0.53
IGL03049:Gm14393 APN 2 175061788 missense probably damaging 1.00
FR4340:Gm14393 UTSW 2 175061634 missense possibly damaging 0.48
FR4976:Gm14393 UTSW 2 175061820 missense probably benign
R1470:Gm14393 UTSW 2 175063981 missense probably damaging 1.00
R1470:Gm14393 UTSW 2 175063981 missense probably damaging 1.00
R3940:Gm14393 UTSW 2 175061627 unclassified probably null
R4214:Gm14393 UTSW 2 175061847 missense probably benign 0.00
R4585:Gm14393 UTSW 2 175062704 unclassified probably benign
R4586:Gm14393 UTSW 2 175062704 unclassified probably benign
R5431:Gm14393 UTSW 2 175063876 missense probably damaging 0.97
R5553:Gm14393 UTSW 2 175061846 nonsense probably null
R5942:Gm14393 UTSW 2 175061896 nonsense probably null
R7154:Gm14393 UTSW 2 175061783 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAATCCTTCCTGCAAAGGC -3'
(R):5'- GCCTTTGCATATGAGAGTTGTAGTC -3'

Sequencing Primer
(F):5'- CTGCAAAGGCTTTACCACATTGG -3'
(R):5'- TATGAGAGTTGTAGTCAAAGGCATC -3'
Posted On2018-06-06