Incidental Mutation 'R6497:Clca3a1'
ID 523052
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Name chloride channel accessory 3A1
Synonyms Clca1
MMRRC Submission 044629-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R6497 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144435438-144466738 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144465020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 71 (V71D)
Ref Sequence ENSEMBL: ENSMUSP00000054526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029932] [ENSMUST00000059091]
AlphaFold Q9QX15
Predicted Effect possibly damaging
Transcript: ENSMUST00000029932
AA Change: V71D

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029932
Gene: ENSMUSG00000056025
AA Change: V71D

DomainStartEndE-ValueType
Pfam:CLCA_N 1 262 5.8e-144 PFAM
VWA 306 473 1.81e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000059091
AA Change: V71D

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054526
Gene: ENSMUSG00000056025
AA Change: V71D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.44e-23 SMART
Blast:FN3 758 857 2e-44 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,793,544 (GRCm39) Y399N probably damaging Het
Acsm3 G A 7: 119,379,972 (GRCm39) probably null Het
Aldh16a1 T A 7: 44,794,361 (GRCm39) S556C possibly damaging Het
Armc7 T C 11: 115,367,077 (GRCm39) I74T probably benign Het
Atp13a4 T C 16: 29,298,719 (GRCm39) D80G probably damaging Het
Bicral A T 17: 47,136,499 (GRCm39) I237K probably damaging Het
Caskin1 T C 17: 24,723,522 (GRCm39) V770A probably benign Het
Cd209c T C 8: 3,994,122 (GRCm39) K113E possibly damaging Het
Cdh20 G A 1: 109,993,528 (GRCm39) probably null Het
Cntnap5a T C 1: 116,505,627 (GRCm39) L1228P probably damaging Het
Cntrl A G 2: 35,025,584 (GRCm39) N85D possibly damaging Het
Coch G A 12: 51,649,504 (GRCm39) V272M probably benign Het
Col22a1 T C 15: 71,762,425 (GRCm39) E78G possibly damaging Het
Cyp2c66 T A 19: 39,151,821 (GRCm39) C179S probably damaging Het
Dsg3 A G 18: 20,670,305 (GRCm39) I681V probably benign Het
Egflam A T 15: 7,280,784 (GRCm39) probably null Het
Fut10 T A 8: 31,726,278 (GRCm39) D344E probably damaging Het
Gad2 C T 2: 22,558,269 (GRCm39) P329L probably damaging Het
Gm14393 T C 2: 174,903,427 (GRCm39) E160G possibly damaging Het
Gprc6a T C 10: 51,491,797 (GRCm39) I476V probably benign Het
Limk2 A G 11: 3,310,492 (GRCm39) F71L probably benign Het
Neb A T 2: 52,148,301 (GRCm39) N2648K possibly damaging Het
Or51f5 T A 7: 102,424,657 (GRCm39) F309I probably benign Het
Or52d1 T C 7: 103,756,422 (GRCm39) probably benign Het
Or8d1b G A 9: 38,887,490 (GRCm39) V173I probably benign Het
Pcdhgb7 T A 18: 37,886,906 (GRCm39) V692E probably damaging Het
Pclo A C 5: 14,843,869 (GRCm39) K4802Q unknown Het
Primpol A T 8: 47,039,376 (GRCm39) probably null Het
Prr14 C T 7: 127,073,750 (GRCm39) R205C probably benign Het
Rbm12b1 T C 4: 12,146,431 (GRCm39) I801T probably benign Het
Ror2 A T 13: 53,285,955 (GRCm39) N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Sh2d4b A G 14: 40,596,139 (GRCm39) V81A probably benign Het
Skint6 A G 4: 113,093,595 (GRCm39) Y183H probably damaging Het
Snapc3 G T 4: 83,371,363 (GRCm39) E388* probably null Het
Srrm4 A T 5: 116,605,550 (GRCm39) S236T unknown Het
Srrt G T 5: 137,295,768 (GRCm39) P193H probably damaging Het
Sspo A T 6: 48,472,142 (GRCm39) T810S possibly damaging Het
Stk36 A G 1: 74,642,391 (GRCm39) H6R probably damaging Het
Tiam2 A G 17: 3,557,102 (GRCm39) T1181A probably damaging Het
Tmem184a A G 5: 139,798,755 (GRCm39) F65L probably damaging Het
Vwa8 A G 14: 79,333,841 (GRCm39) I1330M probably benign Het
Zfp827 T A 8: 79,906,757 (GRCm39) M923K probably damaging Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca3a1 APN 3 144,733,660 (GRCm39) missense probably benign 0.01
IGL00768:Clca3a1 APN 3 144,461,012 (GRCm39) missense probably damaging 0.96
IGL00862:Clca3a1 APN 3 144,730,332 (GRCm39) missense possibly damaging 0.89
IGL00895:Clca3a1 APN 3 144,730,357 (GRCm39) missense probably damaging 1.00
IGL00969:Clca3a1 APN 3 144,714,719 (GRCm39) missense possibly damaging 0.80
IGL01331:Clca3a1 APN 3 144,453,273 (GRCm39) missense probably damaging 1.00
IGL01398:Clca3a1 APN 3 144,722,512 (GRCm39) missense possibly damaging 0.81
IGL01447:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01455:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01457:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01458:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01462:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01473:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01488:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01490:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01632:Clca3a1 APN 3 144,733,202 (GRCm39) missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144,453,333 (GRCm39) nonsense probably null
IGL01896:Clca3a1 APN 3 144,721,438 (GRCm39) missense possibly damaging 0.79
IGL01940:Clca3a1 APN 3 144,452,737 (GRCm39) missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144,460,564 (GRCm39) missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144,457,690 (GRCm39) splice site probably benign
IGL02411:Clca3a1 APN 3 144,733,763 (GRCm39) missense possibly damaging 0.89
IGL03093:Clca3a1 APN 3 144,453,262 (GRCm39) missense probably damaging 0.99
IGL03156:Clca3a1 APN 3 144,719,672 (GRCm39) missense probably damaging 1.00
Lucha UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144,436,640 (GRCm39) missense probably damaging 0.98
R0472:Clca3a1 UTSW 3 144,733,106 (GRCm39) missense probably damaging 1.00
R0513:Clca3a1 UTSW 3 144,466,323 (GRCm39) critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144,454,155 (GRCm39) splice site probably benign
R0571:Clca3a1 UTSW 3 144,713,550 (GRCm39) missense probably damaging 1.00
R0585:Clca3a1 UTSW 3 144,738,386 (GRCm39) missense probably benign 0.16
R0586:Clca3a1 UTSW 3 144,738,350 (GRCm39) missense probably benign 0.45
R0791:Clca3a1 UTSW 3 144,710,615 (GRCm39) missense probably benign 0.01
R1187:Clca3a1 UTSW 3 144,715,504 (GRCm39) missense probably benign 0.30
R1522:Clca3a1 UTSW 3 144,460,932 (GRCm39) missense probably benign 0.01
R1713:Clca3a1 UTSW 3 144,730,307 (GRCm39) missense probably benign 0.00
R1739:Clca3a1 UTSW 3 144,713,539 (GRCm39) missense probably benign 0.00
R1744:Clca3a1 UTSW 3 144,452,596 (GRCm39) missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144,452,590 (GRCm39) missense probably damaging 0.99
R2079:Clca3a1 UTSW 3 144,713,534 (GRCm39) missense possibly damaging 0.80
R2129:Clca3a1 UTSW 3 144,722,526 (GRCm39) missense probably damaging 1.00
R2178:Clca3a1 UTSW 3 144,711,863 (GRCm39) missense probably damaging 1.00
R2234:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2235:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2238:Clca3a1 UTSW 3 144,457,766 (GRCm39) missense possibly damaging 0.94
R2240:Clca3a1 UTSW 3 144,714,746 (GRCm39) missense probably damaging 1.00
R2278:Clca3a1 UTSW 3 144,463,785 (GRCm39) missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144,443,619 (GRCm39) splice site probably null
R3737:Clca3a1 UTSW 3 144,436,482 (GRCm39) missense probably benign 0.01
R3751:Clca3a1 UTSW 3 144,724,424 (GRCm39) missense probably benign 0.01
R3974:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3975:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3981:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144,460,994 (GRCm39) missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144,466,483 (GRCm39) start codon destroyed probably benign 0.08
R4409:Clca3a1 UTSW 3 144,711,788 (GRCm39) missense probably damaging 1.00
R4543:Clca3a1 UTSW 3 144,452,749 (GRCm39) missense probably damaging 1.00
R4586:Clca3a1 UTSW 3 144,722,619 (GRCm39) missense probably damaging 1.00
R4751:Clca3a1 UTSW 3 144,710,609 (GRCm39) missense possibly damaging 0.89
R4766:Clca3a1 UTSW 3 144,455,473 (GRCm39) missense probably damaging 1.00
R4894:Clca3a1 UTSW 3 144,719,662 (GRCm39) missense probably damaging 0.99
R4899:Clca3a1 UTSW 3 144,443,722 (GRCm39) missense probably damaging 1.00
R4909:Clca3a1 UTSW 3 144,730,324 (GRCm39) missense probably damaging 1.00
R4916:Clca3a1 UTSW 3 144,721,605 (GRCm39) missense probably benign 0.01
R4941:Clca3a1 UTSW 3 144,721,414 (GRCm39) missense probably damaging 1.00
R4942:Clca3a1 UTSW 3 144,710,524 (GRCm39) missense probably benign 0.02
R5044:Clca3a1 UTSW 3 144,713,689 (GRCm39) splice site probably null
R5090:Clca3a1 UTSW 3 144,443,633 (GRCm39) missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144,436,483 (GRCm39) missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144,452,545 (GRCm39) missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144,442,897 (GRCm39) missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144,442,766 (GRCm39) missense possibly damaging 0.77
R5451:Clca3a1 UTSW 3 144,733,747 (GRCm39) missense probably damaging 1.00
R5618:Clca3a1 UTSW 3 144,710,738 (GRCm39) missense probably benign 0.00
R5724:Clca3a1 UTSW 3 144,714,833 (GRCm39) missense probably benign 0.01
R5871:Clca3a1 UTSW 3 144,460,642 (GRCm39) missense probably damaging 1.00
R5898:Clca3a1 UTSW 3 144,722,522 (GRCm39) missense possibly damaging 0.89
R5907:Clca3a1 UTSW 3 144,455,403 (GRCm39) intron probably benign
R5976:Clca3a1 UTSW 3 144,452,636 (GRCm39) missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144,463,821 (GRCm39) missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144,464,993 (GRCm39) missense possibly damaging 0.65
R6238:Clca3a1 UTSW 3 144,714,716 (GRCm39) missense probably benign 0.09
R6263:Clca3a1 UTSW 3 144,455,539 (GRCm39) missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144,464,275 (GRCm39) missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144,436,558 (GRCm39) missense probably benign 0.02
R6542:Clca3a1 UTSW 3 144,465,021 (GRCm39) missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144,442,708 (GRCm39) missense probably damaging 1.00
R6590:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6591:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6592:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6690:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6691:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6729:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R6805:Clca3a1 UTSW 3 144,724,428 (GRCm39) missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144,453,329 (GRCm39) missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144,460,967 (GRCm39) missense probably damaging 0.97
R7106:Clca3a1 UTSW 3 144,733,190 (GRCm39) missense probably damaging 0.98
R7121:Clca3a1 UTSW 3 144,717,567 (GRCm39) missense probably damaging 1.00
R7127:Clca3a1 UTSW 3 144,711,806 (GRCm39) missense probably damaging 1.00
R7139:Clca3a1 UTSW 3 144,461,063 (GRCm39) missense possibly damaging 0.58
R7212:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R7444:Clca3a1 UTSW 3 144,733,193 (GRCm39) missense probably damaging 1.00
R7446:Clca3a1 UTSW 3 144,733,188 (GRCm39) missense possibly damaging 0.65
R7535:Clca3a1 UTSW 3 144,724,328 (GRCm39) missense probably damaging 0.99
R7638:Clca3a1 UTSW 3 144,457,723 (GRCm39) missense probably damaging 1.00
R7663:Clca3a1 UTSW 3 144,442,797 (GRCm39) missense probably benign 0.02
R7792:Clca3a1 UTSW 3 144,455,492 (GRCm39) missense possibly damaging 0.95
R7798:Clca3a1 UTSW 3 144,463,723 (GRCm39) missense probably damaging 1.00
R7892:Clca3a1 UTSW 3 144,436,579 (GRCm39) missense probably benign 0.00
R8096:Clca3a1 UTSW 3 144,455,446 (GRCm39) missense probably damaging 1.00
R8305:Clca3a1 UTSW 3 144,464,927 (GRCm39) splice site probably benign
R8416:Clca3a1 UTSW 3 144,460,914 (GRCm39) critical splice donor site probably null
R8437:Clca3a1 UTSW 3 144,710,822 (GRCm39) missense probably benign 0.00
R8446:Clca3a1 UTSW 3 144,454,248 (GRCm39) missense probably damaging 0.97
R8474:Clca3a1 UTSW 3 144,710,792 (GRCm39) missense possibly damaging 0.77
R8496:Clca3a1 UTSW 3 144,453,182 (GRCm39) makesense probably null
R8766:Clca3a1 UTSW 3 144,714,939 (GRCm39) splice site probably benign
R8884:Clca3a1 UTSW 3 144,719,757 (GRCm39) missense probably benign 0.35
R9014:Clca3a1 UTSW 3 144,442,731 (GRCm39) missense probably benign 0.01
R9049:Clca3a1 UTSW 3 144,733,143 (GRCm39) missense probably benign 0.01
R9128:Clca3a1 UTSW 3 144,463,795 (GRCm39) missense probably damaging 1.00
R9306:Clca3a1 UTSW 3 144,730,339 (GRCm39) missense probably damaging 1.00
R9601:Clca3a1 UTSW 3 144,453,310 (GRCm39) missense probably benign 0.27
R9623:Clca3a1 UTSW 3 144,719,698 (GRCm39) missense probably benign 0.03
X0020:Clca3a1 UTSW 3 144,738,421 (GRCm39) missense possibly damaging 0.89
Z1088:Clca3a1 UTSW 3 144,452,714 (GRCm39) missense probably damaging 1.00
Z1176:Clca3a1 UTSW 3 144,719,682 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAGAGCATGTTTGTGTGCA -3'
(R):5'- GCTTTGGGCATGTGGAAATGA -3'

Sequencing Primer
(F):5'- AGAGCATGTTTGTGTGCATCTACAC -3'
(R):5'- TACGGATCCAAGAGATTCAGTC -3'
Posted On 2018-06-06