Incidental Mutation 'R6497:Rbm12b1'
ID523053
Institutional Source Beutler Lab
Gene Symbol Rbm12b1
Ensembl Gene ENSMUSG00000046667
Gene NameRNA binding motif protein 12 B1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R6497 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location12140264-12146731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12146431 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 801 (I801T)
Ref Sequence ENSEMBL: ENSMUSP00000064195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050069] [ENSMUST00000069128]
Predicted Effect probably benign
Transcript: ENSMUST00000050069
AA Change: I801T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000053555
Gene: ENSMUSG00000046667
AA Change: I801T

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069128
AA Change: I801T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064195
Gene: ENSMUSG00000046667
AA Change: I801T

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146416
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,805,105 Y399N probably damaging Het
Acsm3 G A 7: 119,780,749 probably null Het
Aldh16a1 T A 7: 45,144,937 S556C possibly damaging Het
Armc7 T C 11: 115,476,251 I74T probably benign Het
Atp13a4 T C 16: 29,479,901 D80G probably damaging Het
Bicral A T 17: 46,825,573 I237K probably damaging Het
Caskin1 T C 17: 24,504,548 V770A probably benign Het
Cd209c T C 8: 3,944,122 K113E possibly damaging Het
Cdh7 G A 1: 110,065,798 probably null Het
Clca3a1 A T 3: 144,759,259 V71D possibly damaging Het
Cntnap5a T C 1: 116,577,897 L1228P probably damaging Het
Cntrl A G 2: 35,135,572 N85D possibly damaging Het
Coch G A 12: 51,602,721 V272M probably benign Het
Col22a1 T C 15: 71,890,576 E78G possibly damaging Het
Cyp2c66 T A 19: 39,163,377 C179S probably damaging Het
Dsg3 A G 18: 20,537,248 I681V probably benign Het
Egflam A T 15: 7,251,303 probably null Het
Fut10 T A 8: 31,236,250 D344E probably damaging Het
Gad2 C T 2: 22,668,257 P329L probably damaging Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gprc6a T C 10: 51,615,701 I476V probably benign Het
Limk2 A G 11: 3,360,492 F71L probably benign Het
Neb A T 2: 52,258,289 N2648K possibly damaging Het
Olfr561 T A 7: 102,775,450 F309I probably benign Het
Olfr646 T C 7: 104,107,215 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhgb7 T A 18: 37,753,853 V692E probably damaging Het
Pclo A C 5: 14,793,855 K4802Q unknown Het
Primpol A T 8: 46,586,341 probably null Het
Prr14 C T 7: 127,474,578 R205C probably benign Het
Ror2 A T 13: 53,131,919 N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Skint6 A G 4: 113,236,398 Y183H probably damaging Het
Snapc3 G T 4: 83,453,126 E388* probably null Het
Srrm4 A T 5: 116,467,491 S236T unknown Het
Srrt G T 5: 137,297,506 P193H probably damaging Het
Sspo A T 6: 48,495,208 T810S possibly damaging Het
Stk36 A G 1: 74,603,232 H6R probably damaging Het
Tiam2 A G 17: 3,506,827 T1181A probably damaging Het
Tmem184a A G 5: 139,813,000 F65L probably damaging Het
Vwa8 A G 14: 79,096,401 I1330M probably benign Het
Zfp827 T A 8: 79,180,128 M923K probably damaging Het
Other mutations in Rbm12b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Rbm12b1 APN 4 12146038 missense probably damaging 0.99
IGL02103:Rbm12b1 APN 4 12145563 missense probably damaging 0.99
IGL03165:Rbm12b1 APN 4 12145845 missense possibly damaging 0.94
PIT4618001:Rbm12b1 UTSW 4 12145441 missense probably damaging 1.00
R0449:Rbm12b1 UTSW 4 12145507 missense probably benign 0.00
R0528:Rbm12b1 UTSW 4 12145657 missense probably benign 0.00
R0571:Rbm12b1 UTSW 4 12146248 missense probably benign 0.00
R1476:Rbm12b1 UTSW 4 12145817 missense possibly damaging 0.74
R1709:Rbm12b1 UTSW 4 12145827 missense probably benign 0.00
R1759:Rbm12b1 UTSW 4 12145424 missense probably damaging 1.00
R1967:Rbm12b1 UTSW 4 12146304 missense probably benign 0.00
R2055:Rbm12b1 UTSW 4 12145606 missense probably benign 0.05
R2425:Rbm12b1 UTSW 4 12146443 missense probably damaging 0.99
R4015:Rbm12b1 UTSW 4 12145491 missense probably benign 0.04
R4332:Rbm12b1 UTSW 4 12145655 missense probably benign 0.02
R5773:Rbm12b1 UTSW 4 12145765 missense probably damaging 1.00
R7740:Rbm12b1 UTSW 4 12145954 missense probably benign 0.00
R7761:Rbm12b1 UTSW 4 12146460 missense possibly damaging 0.92
R8083:Rbm12b1 UTSW 4 12146409 missense probably damaging 1.00
R8129:Rbm12b1 UTSW 4 12145549 missense probably damaging 1.00
R8389:Rbm12b1 UTSW 4 12146363 missense probably damaging 1.00
R8929:Rbm12b1 UTSW 4 12145689 missense probably benign 0.00
R8930:Rbm12b1 UTSW 4 12145689 missense probably benign 0.00
R8932:Rbm12b1 UTSW 4 12145689 missense probably benign 0.00
Z1088:Rbm12b1 UTSW 4 12146079 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCCTGATGCAAAAGTTACCTCTG -3'
(R):5'- AAATTCTCTTCCACCTGTCAAGAAC -3'

Sequencing Primer
(F):5'- CTTCCATTCAAAGCTAATGCT -3'
(R):5'- TTTAATTAGGGGGTAAAAGAATGTCC -3'
Posted On2018-06-06