Incidental Mutation 'R6497:Srrm4'
ID523057
Institutional Source Beutler Lab
Gene Symbol Srrm4
Ensembl Gene ENSMUSG00000063919
Gene Nameserine/arginine repetitive matrix 4
SynonymsB230202K19Rik, fp, bv, nSR100, 1500001A10Rik, flopsy
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R6497 (G1)
Quality Score198.009
Status Validated
Chromosome5
Chromosomal Location116439275-116591817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116467491 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 236 (S236T)
Ref Sequence ENSEMBL: ENSMUSP00000075488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076124]
Predicted Effect unknown
Transcript: ENSMUST00000076124
AA Change: S236T
SMART Domains Protein: ENSMUSP00000075488
Gene: ENSMUSG00000063919
AA Change: S236T

DomainStartEndE-ValueType
low complexity region 102 202 N/A INTRINSIC
low complexity region 289 299 N/A INTRINSIC
Pfam:SRRM_C 455 518 4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126959
Predicted Effect unknown
Transcript: ENSMUST00000222119
AA Change: S33T
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SRRM4 promotes alternative splicing and inclusion of neural-specific exons in target mRNAs (Calarco et al., 2009 [PubMed 19737518]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Most homozygous null mice die neonatally with respiratory defects while survivors show tremors, head tilt, circling, premature neurogenesis, altered neurite outgrowth, cortical layering and axon guidance. Homozygotes for a spontaneous deletion show inner ear hair cell, balance and hearing defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,805,105 Y399N probably damaging Het
Acsm3 G A 7: 119,780,749 probably null Het
Aldh16a1 T A 7: 45,144,937 S556C possibly damaging Het
Armc7 T C 11: 115,476,251 I74T probably benign Het
Atp13a4 T C 16: 29,479,901 D80G probably damaging Het
Bicral A T 17: 46,825,573 I237K probably damaging Het
Caskin1 T C 17: 24,504,548 V770A probably benign Het
Cd209c T C 8: 3,944,122 K113E possibly damaging Het
Cdh7 G A 1: 110,065,798 probably null Het
Clca3a1 A T 3: 144,759,259 V71D possibly damaging Het
Cntnap5a T C 1: 116,577,897 L1228P probably damaging Het
Cntrl A G 2: 35,135,572 N85D possibly damaging Het
Coch G A 12: 51,602,721 V272M probably benign Het
Col22a1 T C 15: 71,890,576 E78G possibly damaging Het
Cyp2c66 T A 19: 39,163,377 C179S probably damaging Het
Dsg3 A G 18: 20,537,248 I681V probably benign Het
Egflam A T 15: 7,251,303 probably null Het
Fut10 T A 8: 31,236,250 D344E probably damaging Het
Gad2 C T 2: 22,668,257 P329L probably damaging Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gprc6a T C 10: 51,615,701 I476V probably benign Het
Limk2 A G 11: 3,360,492 F71L probably benign Het
Neb A T 2: 52,258,289 N2648K possibly damaging Het
Olfr561 T A 7: 102,775,450 F309I probably benign Het
Olfr646 T C 7: 104,107,215 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhgb7 T A 18: 37,753,853 V692E probably damaging Het
Pclo A C 5: 14,793,855 K4802Q unknown Het
Primpol A T 8: 46,586,341 probably null Het
Prr14 C T 7: 127,474,578 R205C probably benign Het
Rbm12b1 T C 4: 12,146,431 I801T probably benign Het
Ror2 A T 13: 53,131,919 N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Skint6 A G 4: 113,236,398 Y183H probably damaging Het
Snapc3 G T 4: 83,453,126 E388* probably null Het
Srrt G T 5: 137,297,506 P193H probably damaging Het
Sspo A T 6: 48,495,208 T810S possibly damaging Het
Stk36 A G 1: 74,603,232 H6R probably damaging Het
Tiam2 A G 17: 3,506,827 T1181A probably damaging Het
Tmem184a A G 5: 139,813,000 F65L probably damaging Het
Vwa8 A G 14: 79,096,401 I1330M probably benign Het
Zfp827 T A 8: 79,180,128 M923K probably damaging Het
Other mutations in Srrm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Srrm4 APN 5 116446557 missense possibly damaging 0.86
IGL01291:Srrm4 APN 5 116467569 missense unknown
IGL01873:Srrm4 APN 5 116591468 utr 5 prime probably benign
IGL02553:Srrm4 APN 5 116444565 unclassified probably benign
IGL03090:Srrm4 APN 5 116449584 utr 3 prime probably benign
ANU05:Srrm4 UTSW 5 116467569 missense unknown
R0285:Srrm4 UTSW 5 116467789 unclassified probably benign
R0386:Srrm4 UTSW 5 116482378 splice site probably benign
R0825:Srrm4 UTSW 5 116453713 missense unknown
R0845:Srrm4 UTSW 5 116444885 splice site probably null
R1615:Srrm4 UTSW 5 116447300 unclassified probably benign
R1874:Srrm4 UTSW 5 116453506 utr 3 prime probably benign
R2037:Srrm4 UTSW 5 116467828 unclassified probably benign
R3522:Srrm4 UTSW 5 116446544 start codon destroyed probably null
R3968:Srrm4 UTSW 5 116444744 unclassified probably benign
R4507:Srrm4 UTSW 5 116446553 missense probably damaging 0.98
R4771:Srrm4 UTSW 5 116475175 critical splice donor site probably null
R4815:Srrm4 UTSW 5 116475190 missense unknown
R4817:Srrm4 UTSW 5 116477134 missense unknown
R5383:Srrm4 UTSW 5 116471260 unclassified probably benign
R5620:Srrm4 UTSW 5 116449613 utr 3 prime probably benign
R5639:Srrm4 UTSW 5 116591359 missense unknown
R7029:Srrm4 UTSW 5 116444792 unclassified probably benign
R7166:Srrm4 UTSW 5 116471242 missense unknown
R7514:Srrm4 UTSW 5 116446511 missense probably damaging 0.98
R8187:Srrm4 UTSW 5 116449621 missense unknown
R8309:Srrm4 UTSW 5 116591567 start gained probably benign
Z1176:Srrm4 UTSW 5 116453419 nonsense probably null
Z1177:Srrm4 UTSW 5 116453636 missense unknown
Predicted Primers PCR Primer
(F):5'- GAGCCAGTGGGGAATTTTACC -3'
(R):5'- GCTTCTGTCCCACAATGAGTAG -3'

Sequencing Primer
(F):5'- ACCCAGAACTGAATTAAAAGGTATC -3'
(R):5'- TGTCCCACAATGAGTAGCTCCTAAC -3'
Posted On2018-06-06