Incidental Mutation 'R6497:Srrt'
ID523058
Institutional Source Beutler Lab
Gene Symbol Srrt
Ensembl Gene ENSMUSG00000037364
Gene Nameserrate RNA effector molecule homolog (Arabidopsis)
Synonyms2810019G02Rik, Asr2, Ars2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6497 (G1)
Quality Score156.008
Status Validated
Chromosome5
Chromosomal Location137295704-137307674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 137297506 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 193 (P193H)
Ref Sequence ENSEMBL: ENSMUSP00000142351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024099] [ENSMUST00000040873] [ENSMUST00000052825] [ENSMUST00000085934] [ENSMUST00000196109] [ENSMUST00000196208] [ENSMUST00000197466] [ENSMUST00000198526] [ENSMUST00000199243]
Predicted Effect probably benign
Transcript: ENSMUST00000024099
SMART Domains Protein: ENSMUSP00000024099
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 14 563 2e-186 PFAM
Pfam:Abhydrolase_3 146 276 7.5e-9 PFAM
Pfam:AChE_tetra 578 614 3.2e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000040873
AA Change: P551H

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364
AA Change: P551H

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052825
SMART Domains Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

DomainStartEndE-ValueType
Pfam:Peptidase_C78 27 212 5.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085934
SMART Domains Protein: ENSMUSP00000083097
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 15 563 3e-178 PFAM
Pfam:Abhydrolase_3 146 260 1.4e-7 PFAM
Pfam:AChE_tetra 578 613 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184197
Predicted Effect probably damaging
Transcript: ENSMUST00000196109
AA Change: P193H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364
AA Change: P193H

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
Blast:RRM 65 133 2e-15 BLAST
low complexity region 208 237 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Pfam:ARS2 277 498 6.5e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196208
SMART Domains Protein: ENSMUSP00000142427
Gene: ENSMUSG00000023328

DomainStartEndE-ValueType
Pfam:COesterase 14 359 6.5e-134 PFAM
Pfam:Abhydrolase_3 146 284 4.1e-7 PFAM
Pfam:COesterase 355 475 1.5e-25 PFAM
Pfam:AChE_tetra 490 526 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197409
Predicted Effect possibly damaging
Transcript: ENSMUST00000197466
AA Change: P551H

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364
AA Change: P551H

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198526
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199243
AA Change: P551H

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364
AA Change: P551H

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199473
Predicted Effect probably benign
Transcript: ENSMUST00000199605
Predicted Effect probably benign
Transcript: ENSMUST00000199756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200643
Predicted Effect probably benign
Transcript: ENSMUST00000223263
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation, increased apoptosis, and when cultured most fail to hatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,805,105 Y399N probably damaging Het
Acsm3 G A 7: 119,780,749 probably null Het
Aldh16a1 T A 7: 45,144,937 S556C possibly damaging Het
Armc7 T C 11: 115,476,251 I74T probably benign Het
Atp13a4 T C 16: 29,479,901 D80G probably damaging Het
Bicral A T 17: 46,825,573 I237K probably damaging Het
Caskin1 T C 17: 24,504,548 V770A probably benign Het
Cd209c T C 8: 3,944,122 K113E possibly damaging Het
Cdh7 G A 1: 110,065,798 probably null Het
Clca3a1 A T 3: 144,759,259 V71D possibly damaging Het
Cntnap5a T C 1: 116,577,897 L1228P probably damaging Het
Cntrl A G 2: 35,135,572 N85D possibly damaging Het
Coch G A 12: 51,602,721 V272M probably benign Het
Col22a1 T C 15: 71,890,576 E78G possibly damaging Het
Cyp2c66 T A 19: 39,163,377 C179S probably damaging Het
Dsg3 A G 18: 20,537,248 I681V probably benign Het
Egflam A T 15: 7,251,303 probably null Het
Fut10 T A 8: 31,236,250 D344E probably damaging Het
Gad2 C T 2: 22,668,257 P329L probably damaging Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gprc6a T C 10: 51,615,701 I476V probably benign Het
Limk2 A G 11: 3,360,492 F71L probably benign Het
Neb A T 2: 52,258,289 N2648K possibly damaging Het
Olfr561 T A 7: 102,775,450 F309I probably benign Het
Olfr646 T C 7: 104,107,215 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhgb7 T A 18: 37,753,853 V692E probably damaging Het
Pclo A C 5: 14,793,855 K4802Q unknown Het
Primpol A T 8: 46,586,341 probably null Het
Prr14 C T 7: 127,474,578 R205C probably benign Het
Rbm12b1 T C 4: 12,146,431 I801T probably benign Het
Ror2 A T 13: 53,131,919 N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Skint6 A G 4: 113,236,398 Y183H probably damaging Het
Snapc3 G T 4: 83,453,126 E388* probably null Het
Srrm4 A T 5: 116,467,491 S236T unknown Het
Sspo A T 6: 48,495,208 T810S possibly damaging Het
Stk36 A G 1: 74,603,232 H6R probably damaging Het
Tiam2 A G 17: 3,506,827 T1181A probably damaging Het
Tmem184a A G 5: 139,813,000 F65L probably damaging Het
Vwa8 A G 14: 79,096,401 I1330M probably benign Het
Zfp827 T A 8: 79,180,128 M923K probably damaging Het
Other mutations in Srrt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Srrt APN 5 137295978 unclassified probably benign
IGL01062:Srrt APN 5 137296307 missense probably damaging 1.00
IGL02227:Srrt APN 5 137296274 missense probably damaging 1.00
IGL02656:Srrt APN 5 137299676 unclassified probably benign
IGL03105:Srrt APN 5 137299844 missense possibly damaging 0.72
IGL03137:Srrt APN 5 137296117 unclassified probably benign
R0281:Srrt UTSW 5 137296127 unclassified probably benign
R0322:Srrt UTSW 5 137296608 missense probably damaging 1.00
R0347:Srrt UTSW 5 137299676 unclassified probably benign
R1253:Srrt UTSW 5 137300336 missense probably benign 0.01
R1397:Srrt UTSW 5 137300261 missense possibly damaging 0.89
R1520:Srrt UTSW 5 137298766 missense probably damaging 0.99
R1561:Srrt UTSW 5 137300019 missense probably benign 0.24
R1645:Srrt UTSW 5 137302139 nonsense probably null
R1759:Srrt UTSW 5 137302950 missense probably damaging 1.00
R1770:Srrt UTSW 5 137299860 unclassified probably benign
R1795:Srrt UTSW 5 137303012 unclassified probably benign
R1848:Srrt UTSW 5 137296945 missense probably damaging 1.00
R3838:Srrt UTSW 5 137302125 critical splice donor site probably null
R5015:Srrt UTSW 5 137296009 missense probably damaging 1.00
R5068:Srrt UTSW 5 137296541 missense possibly damaging 0.93
R5163:Srrt UTSW 5 137296773 critical splice donor site probably null
R5316:Srrt UTSW 5 137296551 missense probably benign 0.16
R5343:Srrt UTSW 5 137297165 missense probably damaging 1.00
R5351:Srrt UTSW 5 137298284 makesense probably null
R5412:Srrt UTSW 5 137296287 missense probably damaging 1.00
R5806:Srrt UTSW 5 137297917 missense probably damaging 0.98
R6470:Srrt UTSW 5 137302656 missense probably damaging 1.00
R6755:Srrt UTSW 5 137302930 missense probably damaging 1.00
R6828:Srrt UTSW 5 137296968 missense probably damaging 1.00
R6875:Srrt UTSW 5 137298673 missense probably benign 0.00
R7586:Srrt UTSW 5 137302195 missense probably damaging 0.98
R7677:Srrt UTSW 5 137300148 missense probably damaging 0.99
R8027:Srrt UTSW 5 137302499 frame shift probably null
RF018:Srrt UTSW 5 137300000 missense probably benign 0.23
Z1176:Srrt UTSW 5 137298227 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCTCCAGATGGTCGGAAC -3'
(R):5'- GATCCCTGGGTCCTATCCATAAC -3'

Sequencing Primer
(F):5'- TCGGAACTGGCACCTTGATCAG -3'
(R):5'- GGGTCCTATCCATAACCTCCTTTG -3'
Posted On2018-06-06