Incidental Mutation 'R6497:Tmem184a'
ID523059
Institutional Source Beutler Lab
Gene Symbol Tmem184a
Ensembl Gene ENSMUSG00000036687
Gene Nametransmembrane protein 184a
SynonymsSdmg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6497 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location139802485-139819917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139813000 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 65 (F65L)
Ref Sequence ENSEMBL: ENSMUSP00000117714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044002] [ENSMUST00000110832] [ENSMUST00000146780] [ENSMUST00000147328] [ENSMUST00000182839]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044002
AA Change: F89L

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035399
Gene: ENSMUSG00000036687
AA Change: F89L

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 46 54 N/A INTRINSIC
Pfam:Solute_trans_a 82 356 2.2e-93 PFAM
low complexity region 408 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110832
AA Change: F65L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106456
Gene: ENSMUSG00000036687
AA Change: F65L

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
Pfam:Solute_trans_a 55 332 6.7e-101 PFAM
low complexity region 384 411 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146780
AA Change: F65L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117714
Gene: ENSMUSG00000036687
AA Change: F65L

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147328
SMART Domains Protein: ENSMUSP00000119412
Gene: ENSMUSG00000036687

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182839
AA Change: F137L

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138120
Gene: ENSMUSG00000098140
AA Change: F137L

DomainStartEndE-ValueType
Pfam:DUF2372 34 82 2e-14 PFAM
low complexity region 94 102 N/A INTRINSIC
Pfam:Solute_trans_a 127 226 3.5e-36 PFAM
Meta Mutation Damage Score 0.4869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,805,105 Y399N probably damaging Het
Acsm3 G A 7: 119,780,749 probably null Het
Aldh16a1 T A 7: 45,144,937 S556C possibly damaging Het
Armc7 T C 11: 115,476,251 I74T probably benign Het
Atp13a4 T C 16: 29,479,901 D80G probably damaging Het
Bicral A T 17: 46,825,573 I237K probably damaging Het
Caskin1 T C 17: 24,504,548 V770A probably benign Het
Cd209c T C 8: 3,944,122 K113E possibly damaging Het
Cdh7 G A 1: 110,065,798 probably null Het
Clca3a1 A T 3: 144,759,259 V71D possibly damaging Het
Cntnap5a T C 1: 116,577,897 L1228P probably damaging Het
Cntrl A G 2: 35,135,572 N85D possibly damaging Het
Coch G A 12: 51,602,721 V272M probably benign Het
Col22a1 T C 15: 71,890,576 E78G possibly damaging Het
Cyp2c66 T A 19: 39,163,377 C179S probably damaging Het
Dsg3 A G 18: 20,537,248 I681V probably benign Het
Egflam A T 15: 7,251,303 probably null Het
Fut10 T A 8: 31,236,250 D344E probably damaging Het
Gad2 C T 2: 22,668,257 P329L probably damaging Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gprc6a T C 10: 51,615,701 I476V probably benign Het
Limk2 A G 11: 3,360,492 F71L probably benign Het
Neb A T 2: 52,258,289 N2648K possibly damaging Het
Olfr561 T A 7: 102,775,450 F309I probably benign Het
Olfr646 T C 7: 104,107,215 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhgb7 T A 18: 37,753,853 V692E probably damaging Het
Pclo A C 5: 14,793,855 K4802Q unknown Het
Primpol A T 8: 46,586,341 probably null Het
Prr14 C T 7: 127,474,578 R205C probably benign Het
Rbm12b1 T C 4: 12,146,431 I801T probably benign Het
Ror2 A T 13: 53,131,919 N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Skint6 A G 4: 113,236,398 Y183H probably damaging Het
Snapc3 G T 4: 83,453,126 E388* probably null Het
Srrm4 A T 5: 116,467,491 S236T unknown Het
Srrt G T 5: 137,297,506 P193H probably damaging Het
Sspo A T 6: 48,495,208 T810S possibly damaging Het
Stk36 A G 1: 74,603,232 H6R probably damaging Het
Tiam2 A G 17: 3,506,827 T1181A probably damaging Het
Vwa8 A G 14: 79,096,401 I1330M probably benign Het
Zfp827 T A 8: 79,180,128 M923K probably damaging Het
Other mutations in Tmem184a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Tmem184a APN 5 139813144 missense possibly damaging 0.90
IGL02111:Tmem184a APN 5 139813101 missense possibly damaging 0.92
IGL02483:Tmem184a APN 5 139813077 missense probably benign 0.01
IGL03352:Tmem184a APN 5 139813000 missense probably damaging 0.98
R1488:Tmem184a UTSW 5 139807640 missense probably benign 0.14
R1950:Tmem184a UTSW 5 139807626 missense probably damaging 1.00
R3610:Tmem184a UTSW 5 139807955 critical splice donor site probably null
R4690:Tmem184a UTSW 5 139805622 missense probably benign 0.01
R4977:Tmem184a UTSW 5 139808002 missense probably null 0.57
R6247:Tmem184a UTSW 5 139813072 missense probably benign 0.02
R6515:Tmem184a UTSW 5 139808438 missense probably benign 0.39
R7348:Tmem184a UTSW 5 139814054 missense probably null 0.12
R7742:Tmem184a UTSW 5 139806989 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATGCTAGCTCTGGAGAAGGG -3'
(R):5'- TTTCTGAAGACAGCCGGAGC -3'

Sequencing Primer
(F):5'- AGAATCCTACCATGTCTCAGTGACTG -3'
(R):5'- ACAGATGGAGCGCGTGGACA -3'
Posted On2018-06-06