Incidental Mutation 'R6497:Olfr646'
ID 523064
Institutional Source Beutler Lab
Gene Symbol Olfr646
Ensembl Gene ENSMUSG00000073931
Gene Name olfactory receptor 646
Synonyms GA_x6K02T2PBJ9-6841330-6842268, MOR33-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock # R6497 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 104104873-104109766 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to C at 104107215 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098182] [ENSMUST00000138055] [ENSMUST00000214099]
AlphaFold Q8VGW2
Predicted Effect unknown
Transcript: ENSMUST00000098182
AA Change: V312A
SMART Domains Protein: ENSMUSP00000095784
Gene: ENSMUSG00000073931
AA Change: V312A

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.9e-109 PFAM
Pfam:7TM_GPCR_Srsx 32 225 6.1e-10 PFAM
Pfam:7tm_1 38 290 3.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000214099
AA Change: V312A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214291
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,805,105 Y399N probably damaging Het
Acsm3 G A 7: 119,780,749 probably null Het
Aldh16a1 T A 7: 45,144,937 S556C possibly damaging Het
Armc7 T C 11: 115,476,251 I74T probably benign Het
Atp13a4 T C 16: 29,479,901 D80G probably damaging Het
Bicral A T 17: 46,825,573 I237K probably damaging Het
Caskin1 T C 17: 24,504,548 V770A probably benign Het
Cd209c T C 8: 3,944,122 K113E possibly damaging Het
Cdh7 G A 1: 110,065,798 probably null Het
Clca3a1 A T 3: 144,759,259 V71D possibly damaging Het
Cntnap5a T C 1: 116,577,897 L1228P probably damaging Het
Cntrl A G 2: 35,135,572 N85D possibly damaging Het
Coch G A 12: 51,602,721 V272M probably benign Het
Col22a1 T C 15: 71,890,576 E78G possibly damaging Het
Cyp2c66 T A 19: 39,163,377 C179S probably damaging Het
Dsg3 A G 18: 20,537,248 I681V probably benign Het
Egflam A T 15: 7,251,303 probably null Het
Fut10 T A 8: 31,236,250 D344E probably damaging Het
Gad2 C T 2: 22,668,257 P329L probably damaging Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gprc6a T C 10: 51,615,701 I476V probably benign Het
Limk2 A G 11: 3,360,492 F71L probably benign Het
Neb A T 2: 52,258,289 N2648K possibly damaging Het
Olfr561 T A 7: 102,775,450 F309I probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhgb7 T A 18: 37,753,853 V692E probably damaging Het
Pclo A C 5: 14,793,855 K4802Q unknown Het
Primpol A T 8: 46,586,341 probably null Het
Prr14 C T 7: 127,474,578 R205C probably benign Het
Rbm12b1 T C 4: 12,146,431 I801T probably benign Het
Ror2 A T 13: 53,131,919 N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Skint6 A G 4: 113,236,398 Y183H probably damaging Het
Snapc3 G T 4: 83,453,126 E388* probably null Het
Srrm4 A T 5: 116,467,491 S236T unknown Het
Srrt G T 5: 137,297,506 P193H probably damaging Het
Sspo A T 6: 48,495,208 T810S possibly damaging Het
Stk36 A G 1: 74,603,232 H6R probably damaging Het
Tiam2 A G 17: 3,506,827 T1181A probably damaging Het
Tmem184a A G 5: 139,813,000 F65L probably damaging Het
Vwa8 A G 14: 79,096,401 I1330M probably benign Het
Zfp827 T A 8: 79,180,128 M923K probably damaging Het
Other mutations in Olfr646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01779:Olfr646 APN 7 104106633 missense probably damaging 1.00
IGL02454:Olfr646 APN 7 104106612 missense probably damaging 0.96
IGL02588:Olfr646 APN 7 104107053 missense possibly damaging 0.94
IGL02961:Olfr646 APN 7 104107150 nonsense probably null
IGL03092:Olfr646 APN 7 104106647 missense probably damaging 0.99
PIT4402001:Olfr646 UTSW 7 104106450 missense probably damaging 1.00
R0006:Olfr646 UTSW 7 104106320 missense probably benign 0.00
R0109:Olfr646 UTSW 7 104106605 missense probably damaging 1.00
R0109:Olfr646 UTSW 7 104106605 missense probably damaging 1.00
R0601:Olfr646 UTSW 7 104107142 missense possibly damaging 0.83
R0732:Olfr646 UTSW 7 104106294 missense probably damaging 1.00
R1320:Olfr646 UTSW 7 104106480 missense probably damaging 1.00
R1468:Olfr646 UTSW 7 104106689 missense possibly damaging 0.82
R1468:Olfr646 UTSW 7 104106689 missense possibly damaging 0.82
R1513:Olfr646 UTSW 7 104106464 missense probably benign 0.02
R5486:Olfr646 UTSW 7 104106498 missense probably damaging 0.99
R6110:Olfr646 UTSW 7 104106572 missense probably damaging 1.00
R6856:Olfr646 UTSW 7 104106791 missense probably benign 0.00
R7766:Olfr646 UTSW 7 104106994 nonsense probably null
R7789:Olfr646 UTSW 7 104106988 missense probably damaging 0.99
R7844:Olfr646 UTSW 7 104106483 missense probably damaging 1.00
R8888:Olfr646 UTSW 7 104107095 missense probably damaging 1.00
R8895:Olfr646 UTSW 7 104107095 missense probably damaging 1.00
R9167:Olfr646 UTSW 7 104107219 makesense probably null
R9178:Olfr646 UTSW 7 104106513 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTACCTGTGGATCTCACCTTGG -3'
(R):5'- CATCCCTCTGGACCATTCAG -3'

Sequencing Primer
(F):5'- GATCTCACCTTGGTGTCATTCTGG -3'
(R):5'- ATCCCTCTGGACCATTCAGAATTTC -3'
Posted On 2018-06-06