Incidental Mutation 'R6497:Prr14'
ID523066
Institutional Source Beutler Lab
Gene Symbol Prr14
Ensembl Gene ENSMUSG00000030822
Gene Nameproline rich 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6497 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127459611-127476759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127474578 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 205 (R205C)
Ref Sequence ENSEMBL: ENSMUSP00000101899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033095] [ENSMUST00000106292] [ENSMUST00000133817] [ENSMUST00000133938] [ENSMUST00000205432] [ENSMUST00000206915]
Predicted Effect probably benign
Transcript: ENSMUST00000033095
AA Change: R205C

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000033095
Gene: ENSMUSG00000030822
AA Change: R205C

DomainStartEndE-ValueType
low complexity region 241 256 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:Tantalus 485 545 5.6e-28 PFAM
low complexity region 554 564 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106292
AA Change: R205C

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101899
Gene: ENSMUSG00000030822
AA Change: R205C

DomainStartEndE-ValueType
low complexity region 241 256 N/A INTRINSIC
low complexity region 263 273 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
low complexity region 364 387 N/A INTRINSIC
Pfam:Tantalus 487 544 1.7e-26 PFAM
low complexity region 554 564 N/A INTRINSIC
low complexity region 587 603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132124
Predicted Effect unknown
Transcript: ENSMUST00000132819
AA Change: T116M
Predicted Effect probably benign
Transcript: ENSMUST00000133817
Predicted Effect probably benign
Transcript: ENSMUST00000133938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147202
Predicted Effect probably benign
Transcript: ENSMUST00000205432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206118
Predicted Effect probably benign
Transcript: ENSMUST00000206915
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene tethers heterochromatin to the nuclear laminar scaffold by binding heterochromatin protein 1 (HP1) and the nuclear lamina. The tether is broken during mitosis and reforms quickly after mitosis, with the encoded protein first binding HP1 and then attaching to the nuclear lamina. This protein also has been shown to promote MyoD activity and skeletal myogenesis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,805,105 Y399N probably damaging Het
Acsm3 G A 7: 119,780,749 probably null Het
Aldh16a1 T A 7: 45,144,937 S556C possibly damaging Het
Armc7 T C 11: 115,476,251 I74T probably benign Het
Atp13a4 T C 16: 29,479,901 D80G probably damaging Het
Bicral A T 17: 46,825,573 I237K probably damaging Het
Caskin1 T C 17: 24,504,548 V770A probably benign Het
Cd209c T C 8: 3,944,122 K113E possibly damaging Het
Cdh7 G A 1: 110,065,798 probably null Het
Clca3a1 A T 3: 144,759,259 V71D possibly damaging Het
Cntnap5a T C 1: 116,577,897 L1228P probably damaging Het
Cntrl A G 2: 35,135,572 N85D possibly damaging Het
Coch G A 12: 51,602,721 V272M probably benign Het
Col22a1 T C 15: 71,890,576 E78G possibly damaging Het
Cyp2c66 T A 19: 39,163,377 C179S probably damaging Het
Dsg3 A G 18: 20,537,248 I681V probably benign Het
Egflam A T 15: 7,251,303 probably null Het
Fut10 T A 8: 31,236,250 D344E probably damaging Het
Gad2 C T 2: 22,668,257 P329L probably damaging Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gprc6a T C 10: 51,615,701 I476V probably benign Het
Limk2 A G 11: 3,360,492 F71L probably benign Het
Neb A T 2: 52,258,289 N2648K possibly damaging Het
Olfr561 T A 7: 102,775,450 F309I probably benign Het
Olfr646 T C 7: 104,107,215 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhgb7 T A 18: 37,753,853 V692E probably damaging Het
Pclo A C 5: 14,793,855 K4802Q unknown Het
Primpol A T 8: 46,586,341 probably null Het
Rbm12b1 T C 4: 12,146,431 I801T probably benign Het
Ror2 A T 13: 53,131,919 N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Skint6 A G 4: 113,236,398 Y183H probably damaging Het
Snapc3 G T 4: 83,453,126 E388* probably null Het
Srrm4 A T 5: 116,467,491 S236T unknown Het
Srrt G T 5: 137,297,506 P193H probably damaging Het
Sspo A T 6: 48,495,208 T810S possibly damaging Het
Stk36 A G 1: 74,603,232 H6R probably damaging Het
Tiam2 A G 17: 3,506,827 T1181A probably damaging Het
Tmem184a A G 5: 139,813,000 F65L probably damaging Het
Vwa8 A G 14: 79,096,401 I1330M probably benign Het
Zfp827 T A 8: 79,180,128 M923K probably damaging Het
Other mutations in Prr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Prr14 APN 7 127474647 missense probably benign 0.01
IGL01614:Prr14 APN 7 127475133 missense probably damaging 1.00
IGL01655:Prr14 APN 7 127475767 missense probably benign 0.00
IGL02273:Prr14 APN 7 127475936 missense probably damaging 1.00
IGL03033:Prr14 APN 7 127471963 missense probably damaging 1.00
R0364:Prr14 UTSW 7 127474579 missense probably benign 0.01
R0376:Prr14 UTSW 7 127476643 missense probably benign 0.33
R0448:Prr14 UTSW 7 127474726 unclassified probably benign
R0555:Prr14 UTSW 7 127472095 unclassified probably benign
R1462:Prr14 UTSW 7 127473988 critical splice donor site probably null
R1462:Prr14 UTSW 7 127473988 critical splice donor site probably null
R1534:Prr14 UTSW 7 127473982 missense probably benign 0.08
R1982:Prr14 UTSW 7 127475490 missense possibly damaging 0.87
R2357:Prr14 UTSW 7 127475363 missense probably benign 0.02
R4729:Prr14 UTSW 7 127474696 missense probably benign 0.00
R5582:Prr14 UTSW 7 127476397 missense probably damaging 1.00
R5757:Prr14 UTSW 7 127475553 missense possibly damaging 0.65
R6987:Prr14 UTSW 7 127473805 missense possibly damaging 0.94
R7202:Prr14 UTSW 7 127476476 missense probably damaging 0.99
R7376:Prr14 UTSW 7 127476577 missense probably benign
R7380:Prr14 UTSW 7 127476442 missense probably null 1.00
R7426:Prr14 UTSW 7 127475286 missense probably benign 0.00
R7470:Prr14 UTSW 7 127475825 missense probably null 1.00
R8322:Prr14 UTSW 7 127473827 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGTTTTGATGAAGATCAGCCCAAC -3'
(R):5'- CAAGCTTAACCGTGGCAGTTC -3'

Sequencing Primer
(F):5'- GATGAAGATCAGCCCAACCTCATTG -3'
(R):5'- GGCAGTTCCAAATTCTTCAGTC -3'
Posted On2018-06-06