Incidental Mutation 'R6497:Primpol'
ID523069
Institutional Source Beutler Lab
Gene Symbol Primpol
Ensembl Gene ENSMUSG00000038225
Gene Nameprimase and polymerase (DNA-directed)
SynonymsCcdc111
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6497 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location46575594-46617212 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 46586341 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040468] [ENSMUST00000136335] [ENSMUST00000209787] [ENSMUST00000211400]
Predicted Effect probably null
Transcript: ENSMUST00000040468
SMART Domains Protein: ENSMUSP00000036119
Gene: ENSMUSG00000038225

DomainStartEndE-ValueType
Pfam:Herpes_UL52 384 448 1.3e-19 PFAM
low complexity region 465 478 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123328
Predicted Effect probably benign
Transcript: ENSMUST00000136335
Predicted Effect probably null
Transcript: ENSMUST00000209787
Predicted Effect probably benign
Transcript: ENSMUST00000211400
Meta Mutation Damage Score 0.9483 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA primase-polymerase that belongs to a superfamily of archaeao-eukaryotic primases. Members of this family have primase activity, catalyzing the synthesis of short RNA primers that serve as starting points for DNA synthesis, as well as DNA polymerase activity. The encoded protein facilitates DNA damage tolerance by mediating uninterrupted fork progression after UV irradiation and reinitiating DNA synthesis. An allelic variant in this gene is associated with myopia 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mutants are viable and fertile. Mice homozygous for another knock-out allele exhibit selective increase in C to G transversions in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,805,105 Y399N probably damaging Het
Acsm3 G A 7: 119,780,749 probably null Het
Aldh16a1 T A 7: 45,144,937 S556C possibly damaging Het
Armc7 T C 11: 115,476,251 I74T probably benign Het
Atp13a4 T C 16: 29,479,901 D80G probably damaging Het
Bicral A T 17: 46,825,573 I237K probably damaging Het
Caskin1 T C 17: 24,504,548 V770A probably benign Het
Cd209c T C 8: 3,944,122 K113E possibly damaging Het
Cdh7 G A 1: 110,065,798 probably null Het
Clca3a1 A T 3: 144,759,259 V71D possibly damaging Het
Cntnap5a T C 1: 116,577,897 L1228P probably damaging Het
Cntrl A G 2: 35,135,572 N85D possibly damaging Het
Coch G A 12: 51,602,721 V272M probably benign Het
Col22a1 T C 15: 71,890,576 E78G possibly damaging Het
Cyp2c66 T A 19: 39,163,377 C179S probably damaging Het
Dsg3 A G 18: 20,537,248 I681V probably benign Het
Egflam A T 15: 7,251,303 probably null Het
Fut10 T A 8: 31,236,250 D344E probably damaging Het
Gad2 C T 2: 22,668,257 P329L probably damaging Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gprc6a T C 10: 51,615,701 I476V probably benign Het
Limk2 A G 11: 3,360,492 F71L probably benign Het
Neb A T 2: 52,258,289 N2648K possibly damaging Het
Olfr561 T A 7: 102,775,450 F309I probably benign Het
Olfr646 T C 7: 104,107,215 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhgb7 T A 18: 37,753,853 V692E probably damaging Het
Pclo A C 5: 14,793,855 K4802Q unknown Het
Prr14 C T 7: 127,474,578 R205C probably benign Het
Rbm12b1 T C 4: 12,146,431 I801T probably benign Het
Ror2 A T 13: 53,131,919 N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Skint6 A G 4: 113,236,398 Y183H probably damaging Het
Snapc3 G T 4: 83,453,126 E388* probably null Het
Srrm4 A T 5: 116,467,491 S236T unknown Het
Srrt G T 5: 137,297,506 P193H probably damaging Het
Sspo A T 6: 48,495,208 T810S possibly damaging Het
Stk36 A G 1: 74,603,232 H6R probably damaging Het
Tiam2 A G 17: 3,506,827 T1181A probably damaging Het
Tmem184a A G 5: 139,813,000 F65L probably damaging Het
Vwa8 A G 14: 79,096,401 I1330M probably benign Het
Zfp827 T A 8: 79,180,128 M923K probably damaging Het
Other mutations in Primpol
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Primpol APN 8 46581597 missense probably damaging 0.98
IGL02421:Primpol APN 8 46607795 splice site probably benign
IGL02886:Primpol APN 8 46593584 nonsense probably null
IGL03244:Primpol APN 8 46586440 missense probably damaging 1.00
R0243:Primpol UTSW 8 46599814 missense probably damaging 1.00
R0329:Primpol UTSW 8 46610461 missense probably damaging 0.97
R0330:Primpol UTSW 8 46610461 missense probably damaging 0.97
R0571:Primpol UTSW 8 46581639 missense probably damaging 1.00
R1266:Primpol UTSW 8 46593699 missense probably damaging 1.00
R1334:Primpol UTSW 8 46586391 missense probably damaging 1.00
R1469:Primpol UTSW 8 46593637 missense probably benign
R1469:Primpol UTSW 8 46593637 missense probably benign
R1524:Primpol UTSW 8 46586467 intron probably benign
R1738:Primpol UTSW 8 46607838 missense probably damaging 0.98
R2144:Primpol UTSW 8 46586343 missense probably damaging 0.99
R3747:Primpol UTSW 8 46599813 missense probably benign 0.34
R3748:Primpol UTSW 8 46599813 missense probably benign 0.34
R3750:Primpol UTSW 8 46599813 missense probably benign 0.34
R4378:Primpol UTSW 8 46576183 utr 3 prime probably benign
R4855:Primpol UTSW 8 46586691 missense probably benign 0.00
R5209:Primpol UTSW 8 46590260 missense probably benign 0.00
R5497:Primpol UTSW 8 46592622 nonsense probably null
R5720:Primpol UTSW 8 46581642 missense probably damaging 1.00
R5963:Primpol UTSW 8 46593580 missense possibly damaging 0.93
R6164:Primpol UTSW 8 46586442 missense probably benign 0.10
R6549:Primpol UTSW 8 46605150 missense probably damaging 1.00
R7595:Primpol UTSW 8 46610615 missense probably benign 0.00
R7775:Primpol UTSW 8 46586424 missense probably damaging 1.00
R7778:Primpol UTSW 8 46586424 missense probably damaging 1.00
R7824:Primpol UTSW 8 46586424 missense probably damaging 1.00
R8055:Primpol UTSW 8 46579162 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- AAGCTGGTATGTGCTAGAAGTG -3'
(R):5'- AGGTAAGGCTTGGCTTTCTCTC -3'

Sequencing Primer
(F):5'- CTGGTATGTGCTAGAAGTGATTTAAC -3'
(R):5'- AAGACAGTTTCTCGTGCAGC -3'
Posted On2018-06-06