Incidental Mutation 'R6497:Zfp827'
ID523070
Institutional Source Beutler Lab
Gene Symbol Zfp827
Ensembl Gene ENSMUSG00000071064
Gene Namezinc finger protein 827
Synonyms2810449M09Rik, D630040G17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R6497 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location79028437-79193766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79180128 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 923 (M923K)
Ref Sequence ENSEMBL: ENSMUSP00000113199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098614] [ENSMUST00000119254] [ENSMUST00000148713]
Predicted Effect probably damaging
Transcript: ENSMUST00000098614
AA Change: M923K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096214
Gene: ENSMUSG00000071064
AA Change: M923K

DomainStartEndE-ValueType
low complexity region 102 128 N/A INTRINSIC
low complexity region 226 256 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 306 342 N/A INTRINSIC
low complexity region 343 348 N/A INTRINSIC
ZnF_C2H2 371 393 6.78e-3 SMART
ZnF_C2H2 399 421 2.99e-4 SMART
ZnF_C2H2 430 452 5.42e-2 SMART
internal_repeat_2 561 585 3.31e-7 PROSPERO
low complexity region 613 627 N/A INTRINSIC
internal_repeat_2 719 743 3.31e-7 PROSPERO
ZnF_C2H2 814 836 2.4e-3 SMART
ZnF_C2H2 842 864 4.72e-2 SMART
ZnF_C2H2 894 916 1.64e-1 SMART
ZnF_C2H2 926 949 7.89e0 SMART
low complexity region 956 974 N/A INTRINSIC
ZnF_C2H2 1016 1038 1.26e-2 SMART
ZnF_C2H2 1044 1066 3.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119254
AA Change: M923K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113199
Gene: ENSMUSG00000071064
AA Change: M923K

DomainStartEndE-ValueType
low complexity region 102 128 N/A INTRINSIC
low complexity region 226 256 N/A INTRINSIC
low complexity region 271 298 N/A INTRINSIC
low complexity region 306 342 N/A INTRINSIC
low complexity region 343 348 N/A INTRINSIC
ZnF_C2H2 371 393 6.78e-3 SMART
ZnF_C2H2 399 421 2.99e-4 SMART
ZnF_C2H2 430 452 5.42e-2 SMART
internal_repeat_2 561 585 3.25e-7 PROSPERO
low complexity region 613 627 N/A INTRINSIC
internal_repeat_2 719 743 3.25e-7 PROSPERO
ZnF_C2H2 814 836 2.4e-3 SMART
ZnF_C2H2 842 864 4.72e-2 SMART
ZnF_C2H2 894 916 1.64e-1 SMART
ZnF_C2H2 926 949 7.89e0 SMART
low complexity region 956 974 N/A INTRINSIC
ZnF_C2H2 1016 1038 1.26e-2 SMART
ZnF_C2H2 1044 1066 3.07e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129613
AA Change: M63K
SMART Domains Protein: ENSMUSP00000119511
Gene: ENSMUSG00000071064
AA Change: M63K

DomainStartEndE-ValueType
ZnF_C2H2 35 57 1.64e-1 SMART
ZnF_C2H2 67 90 7.89e0 SMART
low complexity region 97 115 N/A INTRINSIC
ZnF_C2H2 157 179 1.26e-2 SMART
ZnF_C2H2 185 207 3.07e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000145827
AA Change: M191K
SMART Domains Protein: ENSMUSP00000114208
Gene: ENSMUSG00000071064
AA Change: M191K

DomainStartEndE-ValueType
ZnF_C2H2 77 99 2.4e-3 SMART
ZnF_C2H2 111 133 4.72e-2 SMART
ZnF_C2H2 163 185 1.64e-1 SMART
ZnF_C2H2 195 218 7.89e0 SMART
low complexity region 225 243 N/A INTRINSIC
ZnF_C2H2 285 307 1.26e-2 SMART
ZnF_C2H2 313 335 3.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148713
AA Change: M215K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120913
Gene: ENSMUSG00000071064
AA Change: M215K

DomainStartEndE-ValueType
ZnF_C2H2 106 128 2.4e-3 SMART
ZnF_C2H2 134 156 4.72e-2 SMART
ZnF_C2H2 186 208 1.64e-1 SMART
ZnF_C2H2 218 241 7.89e0 SMART
low complexity region 248 266 N/A INTRINSIC
ZnF_C2H2 308 330 1.26e-2 SMART
ZnF_C2H2 336 358 3.07e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000155960
AA Change: M139K
SMART Domains Protein: ENSMUSP00000120562
Gene: ENSMUSG00000071064
AA Change: M139K

DomainStartEndE-ValueType
ZnF_C2H2 31 53 2.4e-3 SMART
ZnF_C2H2 59 81 4.72e-2 SMART
ZnF_C2H2 111 133 1.64e-1 SMART
ZnF_C2H2 143 166 7.89e0 SMART
low complexity region 173 191 N/A INTRINSIC
ZnF_C2H2 233 255 1.26e-2 SMART
ZnF_C2H2 261 283 3.07e-1 SMART
ZnF_C2H2 290 312 9.44e-2 SMART
ZnF_C2H2 317 339 4.34e-1 SMART
ZnF_C2H2 345 367 7.9e-4 SMART
ZnF_C2H2 373 396 2.53e-2 SMART
ZnF_C2H2 402 424 2.45e0 SMART
low complexity region 444 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211475
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,805,105 Y399N probably damaging Het
Acsm3 G A 7: 119,780,749 probably null Het
Aldh16a1 T A 7: 45,144,937 S556C possibly damaging Het
Armc7 T C 11: 115,476,251 I74T probably benign Het
Atp13a4 T C 16: 29,479,901 D80G probably damaging Het
Bicral A T 17: 46,825,573 I237K probably damaging Het
Caskin1 T C 17: 24,504,548 V770A probably benign Het
Cd209c T C 8: 3,944,122 K113E possibly damaging Het
Cdh7 G A 1: 110,065,798 probably null Het
Clca3a1 A T 3: 144,759,259 V71D possibly damaging Het
Cntnap5a T C 1: 116,577,897 L1228P probably damaging Het
Cntrl A G 2: 35,135,572 N85D possibly damaging Het
Coch G A 12: 51,602,721 V272M probably benign Het
Col22a1 T C 15: 71,890,576 E78G possibly damaging Het
Cyp2c66 T A 19: 39,163,377 C179S probably damaging Het
Dsg3 A G 18: 20,537,248 I681V probably benign Het
Egflam A T 15: 7,251,303 probably null Het
Fut10 T A 8: 31,236,250 D344E probably damaging Het
Gad2 C T 2: 22,668,257 P329L probably damaging Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gprc6a T C 10: 51,615,701 I476V probably benign Het
Limk2 A G 11: 3,360,492 F71L probably benign Het
Neb A T 2: 52,258,289 N2648K possibly damaging Het
Olfr561 T A 7: 102,775,450 F309I probably benign Het
Olfr646 T C 7: 104,107,215 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhgb7 T A 18: 37,753,853 V692E probably damaging Het
Pclo A C 5: 14,793,855 K4802Q unknown Het
Primpol A T 8: 46,586,341 probably null Het
Prr14 C T 7: 127,474,578 R205C probably benign Het
Rbm12b1 T C 4: 12,146,431 I801T probably benign Het
Ror2 A T 13: 53,131,919 N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Skint6 A G 4: 113,236,398 Y183H probably damaging Het
Snapc3 G T 4: 83,453,126 E388* probably null Het
Srrm4 A T 5: 116,467,491 S236T unknown Het
Srrt G T 5: 137,297,506 P193H probably damaging Het
Sspo A T 6: 48,495,208 T810S possibly damaging Het
Stk36 A G 1: 74,603,232 H6R probably damaging Het
Tiam2 A G 17: 3,506,827 T1181A probably damaging Het
Tmem184a A G 5: 139,813,000 F65L probably damaging Het
Vwa8 A G 14: 79,096,401 I1330M probably benign Het
Other mutations in Zfp827
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Zfp827 APN 8 79060733 missense possibly damaging 0.82
IGL01545:Zfp827 APN 8 79070434 missense probably damaging 1.00
IGL01552:Zfp827 APN 8 79076191 missense probably damaging 1.00
IGL02261:Zfp827 APN 8 79180079 missense probably damaging 0.97
IGL02451:Zfp827 APN 8 79060972 missense probably damaging 1.00
IGL03130:Zfp827 APN 8 79060957 missense probably damaging 1.00
IGL03411:Zfp827 APN 8 79076487 missense probably damaging 0.99
E0354:Zfp827 UTSW 8 79136577 missense probably damaging 1.00
R0502:Zfp827 UTSW 8 79179077 splice site probably null
R0547:Zfp827 UTSW 8 79060310 missense probably damaging 1.00
R0926:Zfp827 UTSW 8 79118192 missense probably benign 0.00
R0975:Zfp827 UTSW 8 79061185 missense probably benign 0.00
R1305:Zfp827 UTSW 8 79060894 missense possibly damaging 0.95
R1462:Zfp827 UTSW 8 79076479 missense probably benign
R1462:Zfp827 UTSW 8 79076479 missense probably benign
R1638:Zfp827 UTSW 8 79076346 missense possibly damaging 0.94
R1714:Zfp827 UTSW 8 79060573 missense probably damaging 1.00
R2044:Zfp827 UTSW 8 79076236 missense probably benign
R2132:Zfp827 UTSW 8 79185721 missense possibly damaging 0.53
R3844:Zfp827 UTSW 8 79136619 missense probably damaging 0.99
R4329:Zfp827 UTSW 8 79189834 utr 3 prime probably benign
R4629:Zfp827 UTSW 8 79060382 missense probably damaging 0.99
R4873:Zfp827 UTSW 8 79060774 missense probably damaging 1.00
R4875:Zfp827 UTSW 8 79060774 missense probably damaging 1.00
R4936:Zfp827 UTSW 8 79061183 missense probably benign
R4965:Zfp827 UTSW 8 79061281 missense probably benign
R5103:Zfp827 UTSW 8 79070403 missense probably damaging 1.00
R5366:Zfp827 UTSW 8 79185704 missense possibly damaging 0.94
R5794:Zfp827 UTSW 8 79070442 missense probably damaging 1.00
R5825:Zfp827 UTSW 8 79179016 missense probably damaging 1.00
R6118:Zfp827 UTSW 8 79076438 missense possibly damaging 0.75
R6236:Zfp827 UTSW 8 79070476 missense probably damaging 1.00
R6263:Zfp827 UTSW 8 79179073 missense probably damaging 1.00
R6306:Zfp827 UTSW 8 79060695 missense probably damaging 1.00
R6490:Zfp827 UTSW 8 79189977 utr 3 prime probably benign
R7250:Zfp827 UTSW 8 79190092 missense
R7290:Zfp827 UTSW 8 79189813 missense possibly damaging 0.86
R7443:Zfp827 UTSW 8 79190418 missense
R7708:Zfp827 UTSW 8 79175962 missense probably damaging 1.00
R7754:Zfp827 UTSW 8 79190329 missense
R7836:Zfp827 UTSW 8 79186350 missense probably damaging 1.00
R7995:Zfp827 UTSW 8 79118258 missense possibly damaging 0.86
R8162:Zfp827 UTSW 8 79060577 nonsense probably null
R8747:Zfp827 UTSW 8 79028687 start codon destroyed probably null
R8798:Zfp827 UTSW 8 79189834 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- AGGAAACCAGTGTTCTCCCG -3'
(R):5'- CTATCACGTGTGGCATGACAAC -3'

Sequencing Primer
(F):5'- CGCCCACTGTGTACCTGAG -3'
(R):5'- TGTCTGCAGCAAATTCCAGG -3'
Posted On2018-06-06