Incidental Mutation 'R6497:Limk2'
ID523074
Institutional Source Beutler Lab
Gene Symbol Limk2
Ensembl Gene ENSMUSG00000020451
Gene NameLIM motif-containing protein kinase 2
SynonymsLimk2a, A930024P04Rik, LIM kinase 2, Limk2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R6497 (G1)
Quality Score221.009
Status Validated
Chromosome11
Chromosomal Location3344256-3409189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3360492 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 71 (F71L)
Ref Sequence ENSEMBL: ENSMUSP00000099162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101638] [ENSMUST00000101640] [ENSMUST00000101642] [ENSMUST00000110029]
PDB Structure
Solution structure of the PDZ domain from mouse LIM domain kinase [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000101638
AA Change: F71L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099162
Gene: ENSMUSG00000020451
AA Change: F71L

DomainStartEndE-ValueType
LIM 11 63 2e-14 SMART
LIM 71 124 4.63e-10 SMART
PDZ 161 239 7.04e-10 SMART
low complexity region 241 255 N/A INTRINSIC
low complexity region 280 306 N/A INTRINSIC
low complexity region 310 322 N/A INTRINSIC
Pfam:Pkinase 331 600 5.3e-48 PFAM
Pfam:Pkinase_Tyr 331 601 4.7e-50 PFAM
Pfam:Kdo 341 497 8.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101640
AA Change: F50L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099163
Gene: ENSMUSG00000020451
AA Change: F50L

DomainStartEndE-ValueType
LIM 7 42 4.91e-1 SMART
LIM 50 103 4.63e-10 SMART
PDZ 140 218 7.04e-10 SMART
low complexity region 220 234 N/A INTRINSIC
low complexity region 259 285 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
Pfam:Pkinase 310 582 1.2e-45 PFAM
Pfam:Pkinase_Tyr 310 586 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101642
AA Change: F50L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099165
Gene: ENSMUSG00000020451
AA Change: F50L

DomainStartEndE-ValueType
LIM 7 42 4.91e-1 SMART
LIM 50 103 4.63e-10 SMART
PDZ 140 218 7.04e-10 SMART
low complexity region 220 234 N/A INTRINSIC
low complexity region 259 285 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
Pfam:Pkinase 310 579 4.9e-48 PFAM
Pfam:Pkinase_Tyr 310 580 4.3e-50 PFAM
Pfam:Kdo 320 476 8.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110029
SMART Domains Protein: ENSMUSP00000105656
Gene: ENSMUSG00000020451

DomainStartEndE-ValueType
PDZ 1 52 4.55e-1 SMART
low complexity region 54 68 N/A INTRINSIC
low complexity region 93 119 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
Pfam:Pkinase 144 411 2.7e-49 PFAM
Pfam:Pkinase_Tyr 144 414 1.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148091
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are approximately 40 known eukaryotic LIM proteins, so named for the LIM domains they contain. LIM domains are highly conserved cysteine-rich structures containing 2 zinc fingers. Although zinc fingers usually function by binding to DNA or RNA, the LIM motif probably mediates protein-protein interactions. LIM kinase-1 and LIM kinase-2 belong to a small subfamily with a unique combination of 2 N-terminal LIM motifs and a C-terminal protein kinase domain. The protein encoded by this gene is phosphorylated and activated by ROCK, a downstream effector of Rho, and the encoded protein, in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. It is thought that this pathway contributes to Rho-induced reorganization of the actin cytoskeleton. At least three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male homozygotes for targeted null mutations exhibit small testes but are fertile. Mutant kidneys have fewer glomeruli and dilated renal tubules, but function normally. Mice homozygous for a gene trap allele or spontaneous mutation have open eyelids at birth, corneal abnormalities and inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,805,105 Y399N probably damaging Het
Acsm3 G A 7: 119,780,749 probably null Het
Aldh16a1 T A 7: 45,144,937 S556C possibly damaging Het
Armc7 T C 11: 115,476,251 I74T probably benign Het
Atp13a4 T C 16: 29,479,901 D80G probably damaging Het
Bicral A T 17: 46,825,573 I237K probably damaging Het
Caskin1 T C 17: 24,504,548 V770A probably benign Het
Cd209c T C 8: 3,944,122 K113E possibly damaging Het
Cdh7 G A 1: 110,065,798 probably null Het
Clca3a1 A T 3: 144,759,259 V71D possibly damaging Het
Cntnap5a T C 1: 116,577,897 L1228P probably damaging Het
Cntrl A G 2: 35,135,572 N85D possibly damaging Het
Coch G A 12: 51,602,721 V272M probably benign Het
Col22a1 T C 15: 71,890,576 E78G possibly damaging Het
Cyp2c66 T A 19: 39,163,377 C179S probably damaging Het
Dsg3 A G 18: 20,537,248 I681V probably benign Het
Egflam A T 15: 7,251,303 probably null Het
Fut10 T A 8: 31,236,250 D344E probably damaging Het
Gad2 C T 2: 22,668,257 P329L probably damaging Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gprc6a T C 10: 51,615,701 I476V probably benign Het
Neb A T 2: 52,258,289 N2648K possibly damaging Het
Olfr561 T A 7: 102,775,450 F309I probably benign Het
Olfr646 T C 7: 104,107,215 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhgb7 T A 18: 37,753,853 V692E probably damaging Het
Pclo A C 5: 14,793,855 K4802Q unknown Het
Primpol A T 8: 46,586,341 probably null Het
Prr14 C T 7: 127,474,578 R205C probably benign Het
Rbm12b1 T C 4: 12,146,431 I801T probably benign Het
Ror2 A T 13: 53,131,919 N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Skint6 A G 4: 113,236,398 Y183H probably damaging Het
Snapc3 G T 4: 83,453,126 E388* probably null Het
Srrm4 A T 5: 116,467,491 S236T unknown Het
Srrt G T 5: 137,297,506 P193H probably damaging Het
Sspo A T 6: 48,495,208 T810S possibly damaging Het
Stk36 A G 1: 74,603,232 H6R probably damaging Het
Tiam2 A G 17: 3,506,827 T1181A probably damaging Het
Tmem184a A G 5: 139,813,000 F65L probably damaging Het
Vwa8 A G 14: 79,096,401 I1330M probably benign Het
Zfp827 T A 8: 79,180,128 M923K probably damaging Het
Other mutations in Limk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Limk2 APN 11 3355475 splice site probably benign
IGL01592:Limk2 APN 11 3359052 missense probably benign 0.00
IGL01716:Limk2 APN 11 3358990 splice site probably null
IGL01911:Limk2 APN 11 3355340 missense probably benign
R0900:Limk2 UTSW 11 3350731 missense probably damaging 1.00
R1587:Limk2 UTSW 11 3353455 missense possibly damaging 0.82
R1632:Limk2 UTSW 11 3346250 missense probably damaging 1.00
R1695:Limk2 UTSW 11 3353275 critical splice donor site probably null
R1712:Limk2 UTSW 11 3358104 splice site probably null
R1792:Limk2 UTSW 11 3358236 missense probably benign
R1982:Limk2 UTSW 11 3355461 missense probably benign 0.00
R3009:Limk2 UTSW 11 3359046 missense probably benign 0.01
R4565:Limk2 UTSW 11 3348634 missense probably damaging 0.98
R4703:Limk2 UTSW 11 3347586 nonsense probably null
R4978:Limk2 UTSW 11 3409069 utr 5 prime probably benign
R5160:Limk2 UTSW 11 3350772 missense probably damaging 1.00
R5460:Limk2 UTSW 11 3352332 missense probably benign 0.30
R6543:Limk2 UTSW 11 3350682 missense probably damaging 1.00
R6666:Limk2 UTSW 11 3360493 missense probably damaging 1.00
R7054:Limk2 UTSW 11 3355448 missense possibly damaging 0.95
R7330:Limk2 UTSW 11 3346311 missense probably benign 0.39
R7681:Limk2 UTSW 11 3353354 missense probably damaging 0.96
R7722:Limk2 UTSW 11 3356092 utr 5 prime probably null
R7745:Limk2 UTSW 11 3355896 missense probably damaging 0.99
R8193:Limk2 UTSW 11 3347691 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GCTCTCACAGATAGTCCTCTG -3'
(R):5'- TTAAACTGGGAGCCAAGCAC -3'

Sequencing Primer
(F):5'- CTAGACCTGTCTTTAGTAAGGGCTC -3'
(R):5'- AGCCAAGCACCCCTGTG -3'
Posted On2018-06-06