Incidental Mutation 'R6497:Col22a1'
ID 523081
Institutional Source Beutler Lab
Gene Symbol Col22a1
Ensembl Gene ENSMUSG00000079022
Gene Name collagen, type XXII, alpha 1
Synonyms C80743, 2310067L16Rik
MMRRC Submission 044629-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6497 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 71667644-71906076 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71762425 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 78 (E78G)
Ref Sequence ENSEMBL: ENSMUSP00000124270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159993] [ENSMUST00000160513] [ENSMUST00000229585]
AlphaFold E9Q7P1
Predicted Effect unknown
Transcript: ENSMUST00000159993
AA Change: E967G
SMART Domains Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: E967G

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
VWA 45 227 1.35e-51 SMART
TSPN 248 436 1.26e-33 SMART
low complexity region 454 470 N/A INTRINSIC
internal_repeat_3 494 555 1.96e-13 PROSPERO
internal_repeat_1 496 643 1.49e-19 PROSPERO
low complexity region 644 657 N/A INTRINSIC
low complexity region 673 707 N/A INTRINSIC
Pfam:Collagen 751 823 1.5e-9 PFAM
Pfam:Collagen 810 863 2.3e-10 PFAM
Pfam:Collagen 869 931 4.8e-11 PFAM
Pfam:Collagen 926 990 1.1e-10 PFAM
Pfam:Collagen 1031 1087 1.7e-10 PFAM
Pfam:Collagen 1104 1162 1.8e-11 PFAM
low complexity region 1173 1227 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
internal_repeat_2 1257 1348 3.25e-18 PROSPERO
internal_repeat_4 1268 1347 9.67e-7 PROSPERO
Pfam:Collagen 1389 1448 4e-10 PFAM
Pfam:Collagen 1481 1540 2.6e-9 PFAM
low complexity region 1546 1558 N/A INTRINSIC
low complexity region 1580 1590 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160513
AA Change: E78G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124270
Gene: ENSMUSG00000079022
AA Change: E78G

DomainStartEndE-ValueType
Pfam:Collagen 1 60 5.7e-13 PFAM
Pfam:Collagen 43 102 1.3e-12 PFAM
Pfam:Collagen 100 143 2.2e-8 PFAM
Pfam:Collagen 142 194 1.9e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000229585
AA Change: E412G
Meta Mutation Damage Score 0.0946 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,793,544 (GRCm39) Y399N probably damaging Het
Acsm3 G A 7: 119,379,972 (GRCm39) probably null Het
Aldh16a1 T A 7: 44,794,361 (GRCm39) S556C possibly damaging Het
Armc7 T C 11: 115,367,077 (GRCm39) I74T probably benign Het
Atp13a4 T C 16: 29,298,719 (GRCm39) D80G probably damaging Het
Bicral A T 17: 47,136,499 (GRCm39) I237K probably damaging Het
Caskin1 T C 17: 24,723,522 (GRCm39) V770A probably benign Het
Cd209c T C 8: 3,994,122 (GRCm39) K113E possibly damaging Het
Cdh20 G A 1: 109,993,528 (GRCm39) probably null Het
Clca3a1 A T 3: 144,465,020 (GRCm39) V71D possibly damaging Het
Cntnap5a T C 1: 116,505,627 (GRCm39) L1228P probably damaging Het
Cntrl A G 2: 35,025,584 (GRCm39) N85D possibly damaging Het
Coch G A 12: 51,649,504 (GRCm39) V272M probably benign Het
Cyp2c66 T A 19: 39,151,821 (GRCm39) C179S probably damaging Het
Dsg3 A G 18: 20,670,305 (GRCm39) I681V probably benign Het
Egflam A T 15: 7,280,784 (GRCm39) probably null Het
Fut10 T A 8: 31,726,278 (GRCm39) D344E probably damaging Het
Gad2 C T 2: 22,558,269 (GRCm39) P329L probably damaging Het
Gm14393 T C 2: 174,903,427 (GRCm39) E160G possibly damaging Het
Gprc6a T C 10: 51,491,797 (GRCm39) I476V probably benign Het
Limk2 A G 11: 3,310,492 (GRCm39) F71L probably benign Het
Neb A T 2: 52,148,301 (GRCm39) N2648K possibly damaging Het
Or51f5 T A 7: 102,424,657 (GRCm39) F309I probably benign Het
Or52d1 T C 7: 103,756,422 (GRCm39) probably benign Het
Or8d1b G A 9: 38,887,490 (GRCm39) V173I probably benign Het
Pcdhgb7 T A 18: 37,886,906 (GRCm39) V692E probably damaging Het
Pclo A C 5: 14,843,869 (GRCm39) K4802Q unknown Het
Primpol A T 8: 47,039,376 (GRCm39) probably null Het
Prr14 C T 7: 127,073,750 (GRCm39) R205C probably benign Het
Rbm12b1 T C 4: 12,146,431 (GRCm39) I801T probably benign Het
Ror2 A T 13: 53,285,955 (GRCm39) N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Sh2d4b A G 14: 40,596,139 (GRCm39) V81A probably benign Het
Skint6 A G 4: 113,093,595 (GRCm39) Y183H probably damaging Het
Snapc3 G T 4: 83,371,363 (GRCm39) E388* probably null Het
Srrm4 A T 5: 116,605,550 (GRCm39) S236T unknown Het
Srrt G T 5: 137,295,768 (GRCm39) P193H probably damaging Het
Sspo A T 6: 48,472,142 (GRCm39) T810S possibly damaging Het
Stk36 A G 1: 74,642,391 (GRCm39) H6R probably damaging Het
Tiam2 A G 17: 3,557,102 (GRCm39) T1181A probably damaging Het
Tmem184a A G 5: 139,798,755 (GRCm39) F65L probably damaging Het
Vwa8 A G 14: 79,333,841 (GRCm39) I1330M probably benign Het
Zfp827 T A 8: 79,906,757 (GRCm39) M923K probably damaging Het
Other mutations in Col22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Col22a1 APN 15 71,732,807 (GRCm39) critical splice donor site probably null
IGL00434:Col22a1 APN 15 71,878,524 (GRCm39) missense possibly damaging 0.71
IGL00721:Col22a1 APN 15 71,718,026 (GRCm39) missense unknown
IGL00902:Col22a1 APN 15 71,836,508 (GRCm39) missense probably damaging 1.00
IGL01311:Col22a1 APN 15 71,845,486 (GRCm39) splice site probably benign
IGL01329:Col22a1 APN 15 71,778,889 (GRCm39) missense probably benign 0.02
IGL01527:Col22a1 APN 15 71,778,880 (GRCm39) missense probably damaging 0.98
IGL01870:Col22a1 APN 15 71,824,377 (GRCm39) missense probably benign 0.07
IGL02002:Col22a1 APN 15 71,682,946 (GRCm39) splice site probably benign
IGL02248:Col22a1 APN 15 71,671,297 (GRCm39) missense unknown
IGL02322:Col22a1 APN 15 71,694,502 (GRCm39) missense unknown
IGL02472:Col22a1 APN 15 71,699,602 (GRCm39) splice site probably benign
IGL02685:Col22a1 APN 15 71,673,764 (GRCm39) missense unknown
IGL02888:Col22a1 APN 15 71,718,068 (GRCm39) missense unknown
IGL02971:Col22a1 APN 15 71,878,587 (GRCm39) missense probably damaging 1.00
IGL03175:Col22a1 APN 15 71,840,952 (GRCm39) missense possibly damaging 0.81
IGL03240:Col22a1 APN 15 71,679,777 (GRCm39) missense unknown
R0083:Col22a1 UTSW 15 71,762,346 (GRCm39) missense possibly damaging 0.70
R0383:Col22a1 UTSW 15 71,740,853 (GRCm39) missense unknown
R0449:Col22a1 UTSW 15 71,834,520 (GRCm39) critical splice donor site probably null
R0508:Col22a1 UTSW 15 71,805,262 (GRCm39) missense unknown
R0944:Col22a1 UTSW 15 71,753,511 (GRCm39) missense probably benign 0.03
R1289:Col22a1 UTSW 15 71,709,226 (GRCm39) missense unknown
R1436:Col22a1 UTSW 15 71,794,806 (GRCm39) splice site probably benign
R1439:Col22a1 UTSW 15 71,824,226 (GRCm39) splice site probably benign
R1460:Col22a1 UTSW 15 71,693,780 (GRCm39) missense unknown
R1680:Col22a1 UTSW 15 71,671,210 (GRCm39) missense unknown
R1715:Col22a1 UTSW 15 71,878,830 (GRCm39) missense possibly damaging 0.79
R1742:Col22a1 UTSW 15 71,673,762 (GRCm39) missense unknown
R1745:Col22a1 UTSW 15 71,878,636 (GRCm39) missense probably damaging 1.00
R1763:Col22a1 UTSW 15 71,879,025 (GRCm39) missense probably damaging 0.96
R1932:Col22a1 UTSW 15 71,741,989 (GRCm39) missense unknown
R2125:Col22a1 UTSW 15 71,720,426 (GRCm39) missense unknown
R2126:Col22a1 UTSW 15 71,729,102 (GRCm39) nonsense probably null
R2137:Col22a1 UTSW 15 71,878,797 (GRCm39) missense possibly damaging 0.46
R2860:Col22a1 UTSW 15 71,687,792 (GRCm39) critical splice donor site probably null
R2861:Col22a1 UTSW 15 71,687,792 (GRCm39) critical splice donor site probably null
R2862:Col22a1 UTSW 15 71,687,792 (GRCm39) critical splice donor site probably null
R3704:Col22a1 UTSW 15 71,842,156 (GRCm39) missense probably damaging 1.00
R3778:Col22a1 UTSW 15 71,845,541 (GRCm39) missense probably damaging 1.00
R3940:Col22a1 UTSW 15 71,853,782 (GRCm39) nonsense probably null
R3950:Col22a1 UTSW 15 71,849,207 (GRCm39) missense possibly damaging 0.90
R4240:Col22a1 UTSW 15 71,878,980 (GRCm39) missense probably damaging 1.00
R4531:Col22a1 UTSW 15 71,878,998 (GRCm39) missense probably damaging 1.00
R4597:Col22a1 UTSW 15 71,836,511 (GRCm39) missense possibly damaging 0.83
R4604:Col22a1 UTSW 15 71,824,188 (GRCm39) missense probably benign 0.36
R4654:Col22a1 UTSW 15 71,845,544 (GRCm39) missense possibly damaging 0.95
R4782:Col22a1 UTSW 15 71,673,774 (GRCm39) missense unknown
R4847:Col22a1 UTSW 15 71,671,348 (GRCm39) missense unknown
R4980:Col22a1 UTSW 15 71,673,792 (GRCm39) missense unknown
R4981:Col22a1 UTSW 15 71,732,915 (GRCm39) missense unknown
R4996:Col22a1 UTSW 15 71,879,010 (GRCm39) missense probably damaging 0.99
R5007:Col22a1 UTSW 15 71,816,271 (GRCm39) missense probably damaging 1.00
R5135:Col22a1 UTSW 15 71,671,186 (GRCm39) missense unknown
R5197:Col22a1 UTSW 15 71,881,255 (GRCm39) missense probably damaging 0.96
R5292:Col22a1 UTSW 15 71,842,185 (GRCm39) missense probably damaging 1.00
R5449:Col22a1 UTSW 15 71,693,798 (GRCm39) missense unknown
R5480:Col22a1 UTSW 15 71,836,460 (GRCm39) missense probably damaging 0.98
R5627:Col22a1 UTSW 15 71,853,767 (GRCm39) missense probably damaging 0.98
R5828:Col22a1 UTSW 15 71,881,340 (GRCm39) missense probably benign 0.01
R5927:Col22a1 UTSW 15 71,878,815 (GRCm39) missense probably damaging 1.00
R6006:Col22a1 UTSW 15 71,845,685 (GRCm39) missense probably damaging 1.00
R6245:Col22a1 UTSW 15 71,845,665 (GRCm39) missense probably damaging 0.99
R6288:Col22a1 UTSW 15 71,766,718 (GRCm39) critical splice acceptor site probably null
R6482:Col22a1 UTSW 15 71,762,338 (GRCm39) missense possibly damaging 0.93
R6579:Col22a1 UTSW 15 71,753,502 (GRCm39) missense probably benign 0.18
R6643:Col22a1 UTSW 15 71,693,886 (GRCm39) splice site probably null
R6663:Col22a1 UTSW 15 71,691,908 (GRCm39) missense unknown
R7179:Col22a1 UTSW 15 71,805,262 (GRCm39) missense unknown
R7215:Col22a1 UTSW 15 71,842,181 (GRCm39) nonsense probably null
R7216:Col22a1 UTSW 15 71,845,694 (GRCm39) missense probably damaging 1.00
R7505:Col22a1 UTSW 15 71,671,248 (GRCm39) nonsense probably null
R7585:Col22a1 UTSW 15 71,764,054 (GRCm39) missense probably damaging 0.99
R7699:Col22a1 UTSW 15 71,845,700 (GRCm39) missense probably damaging 1.00
R7788:Col22a1 UTSW 15 71,824,166 (GRCm39) critical splice donor site probably null
R7921:Col22a1 UTSW 15 71,853,811 (GRCm39) splice site probably null
R8205:Col22a1 UTSW 15 71,732,918 (GRCm39) missense unknown
R8769:Col22a1 UTSW 15 71,878,571 (GRCm39) missense probably benign 0.21
R8780:Col22a1 UTSW 15 71,878,796 (GRCm39) missense probably damaging 0.99
R8827:Col22a1 UTSW 15 71,774,665 (GRCm39) critical splice donor site probably null
R8843:Col22a1 UTSW 15 71,878,503 (GRCm39) missense probably damaging 1.00
R8982:Col22a1 UTSW 15 71,845,487 (GRCm39) critical splice donor site probably null
R9031:Col22a1 UTSW 15 71,753,523 (GRCm39) nonsense probably null
R9036:Col22a1 UTSW 15 71,762,431 (GRCm39) missense probably damaging 1.00
R9084:Col22a1 UTSW 15 71,691,929 (GRCm39) missense unknown
R9281:Col22a1 UTSW 15 71,732,920 (GRCm39) missense unknown
R9386:Col22a1 UTSW 15 71,853,794 (GRCm39) missense probably damaging 1.00
R9406:Col22a1 UTSW 15 71,845,541 (GRCm39) missense probably damaging 1.00
R9577:Col22a1 UTSW 15 71,837,595 (GRCm39) missense probably damaging 0.99
R9727:Col22a1 UTSW 15 71,849,123 (GRCm39) missense probably damaging 1.00
X0066:Col22a1 UTSW 15 71,718,049 (GRCm39) missense unknown
X0066:Col22a1 UTSW 15 71,673,728 (GRCm39) missense unknown
Y5406:Col22a1 UTSW 15 71,671,364 (GRCm39) missense unknown
Z1177:Col22a1 UTSW 15 71,786,969 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGTGCATCACCTAGGGCTTG -3'
(R):5'- CTTCAGCATGTGAATGTGGG -3'

Sequencing Primer
(F):5'- CCTAGGGCTTGCTTTCTAAAATAAG -3'
(R):5'- TGGGGAACAGAGTTCAACTTCTCAC -3'
Posted On 2018-06-06