Incidental Mutation 'R6497:Bicral'
ID523085
Institutional Source Beutler Lab
Gene Symbol Bicral
Ensembl Gene ENSMUSG00000036568
Gene NameBRD4 interacting chromatin remodeling complex associated protein like
SynonymsBC032203, Gltscr1l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6497 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46798116-46831413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46825573 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 237 (I237K)
Ref Sequence ENSEMBL: ENSMUSP00000044833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040624]
Predicted Effect probably damaging
Transcript: ENSMUST00000040624
AA Change: I237K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044833
Gene: ENSMUSG00000036568
AA Change: I237K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Pfam:GLTSCR1 701 808 4.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal embryo turning, embryonic growth retardation, cardiac hypertrophy, and complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,805,105 Y399N probably damaging Het
Acsm3 G A 7: 119,780,749 probably null Het
Aldh16a1 T A 7: 45,144,937 S556C possibly damaging Het
Armc7 T C 11: 115,476,251 I74T probably benign Het
Atp13a4 T C 16: 29,479,901 D80G probably damaging Het
Caskin1 T C 17: 24,504,548 V770A probably benign Het
Cd209c T C 8: 3,944,122 K113E possibly damaging Het
Cdh7 G A 1: 110,065,798 probably null Het
Clca3a1 A T 3: 144,759,259 V71D possibly damaging Het
Cntnap5a T C 1: 116,577,897 L1228P probably damaging Het
Cntrl A G 2: 35,135,572 N85D possibly damaging Het
Coch G A 12: 51,602,721 V272M probably benign Het
Col22a1 T C 15: 71,890,576 E78G possibly damaging Het
Cyp2c66 T A 19: 39,163,377 C179S probably damaging Het
Dsg3 A G 18: 20,537,248 I681V probably benign Het
Egflam A T 15: 7,251,303 probably null Het
Fut10 T A 8: 31,236,250 D344E probably damaging Het
Gad2 C T 2: 22,668,257 P329L probably damaging Het
Gm14393 T C 2: 175,061,634 E160G possibly damaging Het
Gprc6a T C 10: 51,615,701 I476V probably benign Het
Limk2 A G 11: 3,360,492 F71L probably benign Het
Neb A T 2: 52,258,289 N2648K possibly damaging Het
Olfr561 T A 7: 102,775,450 F309I probably benign Het
Olfr646 T C 7: 104,107,215 probably benign Het
Olfr933 G A 9: 38,976,194 V173I probably benign Het
Pcdhgb7 T A 18: 37,753,853 V692E probably damaging Het
Pclo A C 5: 14,793,855 K4802Q unknown Het
Primpol A T 8: 46,586,341 probably null Het
Prr14 C T 7: 127,474,578 R205C probably benign Het
Rbm12b1 T C 4: 12,146,431 I801T probably benign Het
Ror2 A T 13: 53,131,919 N86K probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Skint6 A G 4: 113,236,398 Y183H probably damaging Het
Snapc3 G T 4: 83,453,126 E388* probably null Het
Srrm4 A T 5: 116,467,491 S236T unknown Het
Srrt G T 5: 137,297,506 P193H probably damaging Het
Sspo A T 6: 48,495,208 T810S possibly damaging Het
Stk36 A G 1: 74,603,232 H6R probably damaging Het
Tiam2 A G 17: 3,506,827 T1181A probably damaging Het
Tmem184a A G 5: 139,813,000 F65L probably damaging Het
Vwa8 A G 14: 79,096,401 I1330M probably benign Het
Zfp827 T A 8: 79,180,128 M923K probably damaging Het
Other mutations in Bicral
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Bicral APN 17 46825352 missense probably benign 0.01
IGL01068:Bicral APN 17 46825391 missense probably damaging 1.00
IGL01899:Bicral APN 17 46824674 missense probably benign 0.08
IGL02321:Bicral APN 17 46811947 missense probably benign 0.01
IGL02425:Bicral APN 17 46808454 missense probably benign 0.05
R0091:Bicral UTSW 17 46825307 missense probably damaging 1.00
R0268:Bicral UTSW 17 46814052 splice site probably benign
R0344:Bicral UTSW 17 46814052 splice site probably benign
R0508:Bicral UTSW 17 46825401 missense possibly damaging 0.61
R0589:Bicral UTSW 17 46801596 missense probably benign 0.00
R1442:Bicral UTSW 17 46801724 missense probably benign 0.05
R1468:Bicral UTSW 17 46824593 missense probably benign 0.00
R1468:Bicral UTSW 17 46824593 missense probably benign 0.00
R1874:Bicral UTSW 17 46825178 missense probably benign 0.30
R2057:Bicral UTSW 17 46824888 missense possibly damaging 0.69
R2120:Bicral UTSW 17 46824815 missense probably benign 0.02
R2190:Bicral UTSW 17 46825123 missense probably damaging 0.98
R3737:Bicral UTSW 17 46825910 missense probably damaging 1.00
R3961:Bicral UTSW 17 46824825 missense probably damaging 0.96
R3977:Bicral UTSW 17 46830991 start codon destroyed unknown
R3979:Bicral UTSW 17 46830991 start codon destroyed unknown
R4183:Bicral UTSW 17 46814029 missense probably damaging 1.00
R4876:Bicral UTSW 17 46825576 missense probably damaging 1.00
R5104:Bicral UTSW 17 46801256 missense probably damaging 0.98
R5310:Bicral UTSW 17 46813983 missense possibly damaging 0.89
R5493:Bicral UTSW 17 46801694 missense possibly damaging 0.77
R5610:Bicral UTSW 17 46808492 missense probably damaging 0.99
R5656:Bicral UTSW 17 46808369 missense probably damaging 0.99
R5771:Bicral UTSW 17 46825358 missense possibly damaging 0.59
R5891:Bicral UTSW 17 46801229 missense probably benign
R6426:Bicral UTSW 17 46830079 missense probably benign 0.36
R7025:Bicral UTSW 17 46801668 missense probably benign
R7037:Bicral UTSW 17 46824634 missense probably benign 0.08
R7440:Bicral UTSW 17 46825784 missense probably damaging 1.00
R7997:Bicral UTSW 17 46801608 missense probably benign 0.37
R8680:Bicral UTSW 17 46830947 splice site probably benign
R8802:Bicral UTSW 17 46824700 missense probably benign 0.28
V3553:Bicral UTSW 17 46830095 missense probably damaging 1.00
X0019:Bicral UTSW 17 46825821 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCACGGGTAAAGATGCCTG -3'
(R):5'- AGGTCAGACACTGCAGCCTATC -3'

Sequencing Primer
(F):5'- AAGATGCCTGGAAATTTGTGC -3'
(R):5'- CATCGTTTGCAAGCAATACAGTGG -3'
Posted On2018-06-06