Incidental Mutation 'R6498:Gm13212'
ID523096
Institutional Source Beutler Lab
Gene Symbol Gm13212
Ensembl Gene ENSMUSG00000078502
Gene Namepredicted gene 13212
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R6498 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location145585166-145625345 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145622889 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 299 (C299S)
Ref Sequence ENSEMBL: ENSMUSP00000095402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097794] [ENSMUST00000105739] [ENSMUST00000119718]
Predicted Effect probably damaging
Transcript: ENSMUST00000097794
AA Change: C299S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095402
Gene: ENSMUSG00000078502
AA Change: C299S

DomainStartEndE-ValueType
KRAB 13 72 3.23e-18 SMART
ZnF_C2H2 238 260 1.69e-3 SMART
ZnF_C2H2 266 288 1.18e-2 SMART
ZnF_C2H2 294 316 1.3e-4 SMART
ZnF_C2H2 322 344 1.58e-3 SMART
ZnF_C2H2 350 372 4.24e-4 SMART
ZnF_C2H2 378 400 1.06e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105739
AA Change: C299S
SMART Domains Protein: ENSMUSP00000101365
Gene: ENSMUSG00000078502
AA Change: C299S

DomainStartEndE-ValueType
KRAB 13 72 3.23e-18 SMART
ZnF_C2H2 238 260 1.69e-3 SMART
ZnF_C2H2 266 288 1.18e-2 SMART
ZnF_C2H2 294 316 1.3e-4 SMART
ZnF_C2H2 322 344 1.58e-3 SMART
ZnF_C2H2 350 372 4.24e-4 SMART
ZnF_C2H2 378 400 1.06e-4 SMART
ZnF_C2H2 406 428 1.58e-3 SMART
ZnF_C2H2 434 456 3.39e-3 SMART
ZnF_C2H2 462 484 1.06e-4 SMART
ZnF_C2H2 490 512 1.58e-3 SMART
ZnF_C2H2 518 540 3.39e-3 SMART
ZnF_C2H2 546 568 3.39e-3 SMART
ZnF_C2H2 574 596 3.39e-3 SMART
ZnF_C2H2 602 624 3.39e-3 SMART
ZnF_C2H2 630 652 1.06e-4 SMART
ZnF_C2H2 658 680 1.58e-3 SMART
ZnF_C2H2 686 708 3.39e-3 SMART
ZnF_C2H2 714 736 1.3e-4 SMART
ZnF_C2H2 742 764 1.3e-4 SMART
ZnF_C2H2 770 792 4.79e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119718
SMART Domains Protein: ENSMUSP00000112918
Gene: ENSMUSG00000078502

DomainStartEndE-ValueType
KRAB 13 72 3.23e-18 SMART
internal_repeat_1 141 211 2.19e-13 PROSPERO
ZnF_C2H2 238 260 1.69e-3 SMART
ZnF_C2H2 266 288 1.18e-2 SMART
low complexity region 320 335 N/A INTRINSIC
low complexity region 350 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180968
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Gm13212
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01797:Gm13212 APN 4 145620671 missense probably damaging 0.98
IGL02678:Gm13212 APN 4 145622497 missense probably damaging 1.00
IGL03035:Gm13212 APN 4 145622232 missense possibly damaging 0.77
R0090:Gm13212 UTSW 4 145622625 nonsense probably null
R0904:Gm13212 UTSW 4 145622175 missense possibly damaging 0.95
R1617:Gm13212 UTSW 4 145624307 utr 3 prime probably benign
R1851:Gm13212 UTSW 4 145624250 unclassified probably benign
R1864:Gm13212 UTSW 4 145622428 missense possibly damaging 0.92
R2093:Gm13212 UTSW 4 145622569 missense probably benign 0.02
R2132:Gm13212 UTSW 4 145624233 unclassified probably benign
R2240:Gm13212 UTSW 4 145585321 start gained probably benign
R4177:Gm13212 UTSW 4 145620655 missense probably damaging 1.00
R4584:Gm13212 UTSW 4 145617177 critical splice donor site probably null
R4991:Gm13212 UTSW 4 145622334 missense probably benign 0.31
R5164:Gm13212 UTSW 4 145622205 missense probably damaging 1.00
R6175:Gm13212 UTSW 4 145624241 unclassified probably benign
R6176:Gm13212 UTSW 4 145624058 nonsense probably null
R6984:Gm13212 UTSW 4 145620616 missense probably damaging 1.00
R7134:Gm13212 UTSW 4 145622805 missense possibly damaging 0.93
V5622:Gm13212 UTSW 4 145585321 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CACAACCGAAATGCAGAATTTG -3'
(R):5'- TGATGAATTCTCAGACTGCCG -3'

Sequencing Primer
(F):5'- TCCATCAGGGAATTCATGCAG -3'
(R):5'- CTCAGACTGCCGTTTTTAGTAAAGC -3'
Posted On2018-06-06