Incidental Mutation 'R6498:Vmn1r44'
ID523103
Institutional Source Beutler Lab
Gene Symbol Vmn1r44
Ensembl Gene ENSMUSG00000068234
Gene Namevomeronasal 1 receptor 44
SynonymsV1rb4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6498 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location89883660-89894888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89893580 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 103 (T103A)
Ref Sequence ENSEMBL: ENSMUSP00000154809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089420] [ENSMUST00000204656] [ENSMUST00000226120] [ENSMUST00000226171] [ENSMUST00000226345] [ENSMUST00000226760] [ENSMUST00000227047] [ENSMUST00000227456] [ENSMUST00000227625] [ENSMUST00000227747] [ENSMUST00000227888] [ENSMUST00000228183] [ENSMUST00000228700]
Predicted Effect probably benign
Transcript: ENSMUST00000089420
AA Change: T103A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100706
Gene: ENSMUSG00000068234
AA Change: T103A

DomainStartEndE-ValueType
Pfam:TAS2R 7 305 3.6e-10 PFAM
Pfam:V1R 38 302 5.6e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204656
AA Change: T103A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145135
Gene: ENSMUSG00000068234
AA Change: T103A

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 70 2.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226120
Predicted Effect probably benign
Transcript: ENSMUST00000226171
Predicted Effect probably benign
Transcript: ENSMUST00000226345
AA Change: T103A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000226760
AA Change: T103A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227047
AA Change: T103A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227456
AA Change: T103A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227625
Predicted Effect probably benign
Transcript: ENSMUST00000227747
Predicted Effect probably benign
Transcript: ENSMUST00000227888
Predicted Effect probably benign
Transcript: ENSMUST00000228183
Predicted Effect probably benign
Transcript: ENSMUST00000228700
AA Change: T103A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Vmn1r44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Vmn1r44 APN 6 89893824 missense probably benign 0.45
R1401:Vmn1r44 UTSW 6 89893650 missense probably benign 0.02
R4171:Vmn1r44 UTSW 6 89894014 missense probably damaging 1.00
R4579:Vmn1r44 UTSW 6 89893933 missense possibly damaging 0.75
R5265:Vmn1r44 UTSW 6 89893839 missense probably benign 0.00
R6264:Vmn1r44 UTSW 6 89893670 missense probably benign 0.01
R6994:Vmn1r44 UTSW 6 89894158 missense probably benign 0.00
R7025:Vmn1r44 UTSW 6 89893754 missense possibly damaging 0.95
R7456:Vmn1r44 UTSW 6 89893419 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TCTGCATGCTCCTTGGTGAG -3'
(R):5'- TGAGCAGGACTGAGTAACATAC -3'

Sequencing Primer
(F):5'- CATGCTCCTTGGTGAGAACAG -3'
(R):5'- AAATTCTCTGAGGTCAAATTGGGG -3'
Posted On2018-06-06