Incidental Mutation 'R6498:H2afy2'
ID523111
Institutional Source Beutler Lab
Gene Symbol H2afy2
Ensembl Gene ENSMUSG00000020086
Gene NameH2A histone family, member Y2
SynonymsmacroH2A2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R6498 (G1)
Quality Score159.009
Status Validated
Chromosome10
Chromosomal Location61738665-61784147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61757835 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 21 (V21F)
Ref Sequence ENSEMBL: ENSMUSP00000020283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020283]
Predicted Effect probably damaging
Transcript: ENSMUST00000020283
AA Change: V21F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020283
Gene: ENSMUSG00000020086
AA Change: V21F

DomainStartEndE-ValueType
H2A 3 120 5.3e-67 SMART
low complexity region 134 151 N/A INTRINSIC
low complexity region 157 167 N/A INTRINSIC
Pfam:Macro 216 330 1.8e-28 PFAM
low complexity region 339 345 N/A INTRINSIC
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and may participate in stable X chromosome inactivation. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele do not exhibit any developmental or reproductive abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Fen1 G T 19: 10,200,115 R322S probably damaging Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in H2afy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:H2afy2 APN 10 61757771 missense probably damaging 0.96
lown UTSW 10 61757835 missense probably damaging 0.99
R0551:H2afy2 UTSW 10 61741166 missense probably damaging 0.99
R1371:H2afy2 UTSW 10 61749333 missense possibly damaging 0.70
R4830:H2afy2 UTSW 10 61739353 missense possibly damaging 0.95
R5394:H2afy2 UTSW 10 61751687 missense possibly damaging 0.89
R5541:H2afy2 UTSW 10 61747717 missense probably benign 0.20
R6029:H2afy2 UTSW 10 61747762 missense possibly damaging 0.75
R6735:H2afy2 UTSW 10 61741267 missense probably damaging 0.98
R7139:H2afy2 UTSW 10 61757895 start codon destroyed unknown
Predicted Primers PCR Primer
(F):5'- GCGGGAATTGGGAGATTCAC -3'
(R):5'- AGCCAGAAATGTCACAATGTGTC -3'

Sequencing Primer
(F):5'- TTGGGAGATTCACAGCAGCCTG -3'
(R):5'- TGTGTCCTAAAGCCACACTGATG -3'
Posted On2018-06-06