Incidental Mutation 'R6498:Arrb2'
ID 523113
Institutional Source Beutler Lab
Gene Symbol Arrb2
Ensembl Gene ENSMUSG00000060216
Gene Name arrestin, beta 2
Synonyms beta-arrestin-2, Arr3, beta-arrestin2, beta arr2, arrestin 3
MMRRC Submission 044630-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6498 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 70323461-70331654 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 70330375 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 333 (R333L)
Ref Sequence ENSEMBL: ENSMUSP00000104208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079056] [ENSMUST00000084954] [ENSMUST00000102563] [ENSMUST00000102564] [ENSMUST00000108568] [ENSMUST00000124943] [ENSMUST00000150076] [ENSMUST00000128748]
AlphaFold Q91YI4
Predicted Effect probably benign
Transcript: ENSMUST00000079056
AA Change: R333L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000078065
Gene: ENSMUSG00000060216
AA Change: R333L

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 175 8.3e-37 PFAM
Arrestin_C 195 350 5.2e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084954
AA Change: R318L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082018
Gene: ENSMUSG00000060216
AA Change: R318L

DomainStartEndE-ValueType
Pfam:Arrestin_N 36 160 1.7e-25 PFAM
Arrestin_C 180 335 6.53e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102563
AA Change: R333L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099623
Gene: ENSMUSG00000060216
AA Change: R333L

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 175 1.5e-36 PFAM
Arrestin_C 195 350 6.53e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102564
AA Change: R333L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099624
Gene: ENSMUSG00000060216
AA Change: R333L

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 175 1.5e-36 PFAM
Arrestin_C 195 350 6.53e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108568
AA Change: R333L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104208
Gene: ENSMUSG00000060216
AA Change: R333L

DomainStartEndE-ValueType
Pfam:Arrestin_N 19 175 2.6e-34 PFAM
Arrestin_C 195 350 5.1e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125441
Predicted Effect probably benign
Transcript: ENSMUST00000124943
SMART Domains Protein: ENSMUSP00000136978
Gene: ENSMUSG00000060216

DomainStartEndE-ValueType
Pfam:Arrestin_N 4 83 6.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144454
Predicted Effect probably benign
Transcript: ENSMUST00000128748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143232
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138006
Meta Mutation Damage Score 0.0783 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced morphine analgesia, an enhanced inflammatory response and reduced threshold to lethal endotoxin challenge, and impaired T and B lymphocyte chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,182,928 (GRCm39) N1043T possibly damaging Het
Actn2 C T 13: 12,291,359 (GRCm39) E682K probably damaging Het
Agtpbp1 A G 13: 59,624,854 (GRCm39) V833A possibly damaging Het
Atp9b C T 18: 80,820,230 (GRCm39) S135N probably benign Het
Cep112 T A 11: 108,331,357 (GRCm39) S135R probably benign Het
D630045J12Rik G A 6: 38,124,132 (GRCm39) R1607* probably null Het
Duox1 A T 2: 122,150,088 (GRCm39) S160C probably damaging Het
Eogt A T 6: 97,112,174 (GRCm39) Y160N probably damaging Het
Exosc10 T C 4: 148,657,795 (GRCm39) V647A probably benign Het
Fbxo44 C T 4: 148,238,882 (GRCm39) Het
Fen1 G T 19: 10,177,479 (GRCm39) R322S probably damaging Het
Gls A C 1: 52,259,198 (GRCm39) N134K probably benign Het
Hspg2 T C 4: 137,235,112 (GRCm39) V82A possibly damaging Het
Il33 G A 19: 29,927,137 (GRCm39) E23K probably benign Het
Macroh2a2 C A 10: 61,593,614 (GRCm39) V21F probably damaging Het
Map2k5 C A 9: 63,193,683 (GRCm39) A266S possibly damaging Het
Or13g1 T C 7: 85,956,226 (GRCm39) I32V probably benign Het
Or2t29 T A 11: 58,433,408 (GRCm39) N298I probably damaging Het
Or5p61 C T 7: 107,758,639 (GRCm39) C147Y probably benign Het
Pcdh1 G A 18: 38,330,490 (GRCm39) P838S probably benign Het
Pcdha5 A G 18: 37,095,768 (GRCm39) E759G possibly damaging Het
Pclo T C 5: 14,719,505 (GRCm39) I1214T unknown Het
Per3 T C 4: 151,113,662 (GRCm39) I299V probably benign Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Synpo2 A T 3: 122,873,881 (GRCm39) probably null Het
Sys1 G A 2: 164,306,438 (GRCm39) A131T probably benign Het
Tekt2 A G 4: 126,218,098 (GRCm39) L138P probably benign Het
Tmprss12 T A 15: 100,183,133 (GRCm39) N158K probably damaging Het
Tnrc18 A T 5: 142,717,923 (GRCm39) M2177K unknown Het
Trim43a T A 9: 88,464,395 (GRCm39) I102N probably damaging Het
Ugt1a10 C A 1: 88,143,862 (GRCm39) H361N probably damaging Het
Utrn C T 10: 12,317,837 (GRCm39) C498Y probably benign Het
Vmn1r39 A T 6: 66,781,841 (GRCm39) V159D probably damaging Het
Vmn1r44 A G 6: 89,870,562 (GRCm39) T103A probably benign Het
Wsb1 A T 11: 79,139,315 (GRCm39) V127D probably damaging Het
Zfp268 T A 4: 145,349,459 (GRCm39) C299S probably damaging Het
Other mutations in Arrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Arrb2 APN 11 70,327,697 (GRCm39) missense probably damaging 0.99
IGL02484:Arrb2 APN 11 70,330,300 (GRCm39) missense probably damaging 0.99
IGL02550:Arrb2 APN 11 70,327,696 (GRCm39) missense probably damaging 0.96
IGL03375:Arrb2 APN 11 70,327,005 (GRCm39) missense probably damaging 1.00
FR4340:Arrb2 UTSW 11 70,329,497 (GRCm39) missense probably damaging 1.00
FR4342:Arrb2 UTSW 11 70,329,497 (GRCm39) missense probably damaging 1.00
FR4589:Arrb2 UTSW 11 70,329,497 (GRCm39) missense probably damaging 1.00
R1663:Arrb2 UTSW 11 70,328,429 (GRCm39) missense probably damaging 1.00
R1903:Arrb2 UTSW 11 70,328,808 (GRCm39) missense probably damaging 1.00
R4906:Arrb2 UTSW 11 70,330,725 (GRCm39) missense probably benign 0.20
R5389:Arrb2 UTSW 11 70,329,484 (GRCm39) missense probably damaging 0.97
R6800:Arrb2 UTSW 11 70,328,142 (GRCm39) nonsense probably null
R7432:Arrb2 UTSW 11 70,328,796 (GRCm39) missense probably benign 0.00
R9342:Arrb2 UTSW 11 70,327,463 (GRCm39) missense probably benign 0.19
R9655:Arrb2 UTSW 11 70,331,073 (GRCm39) missense probably null 0.09
Predicted Primers PCR Primer
(F):5'- GGATGCCATGAGCCTGTATG -3'
(R):5'- GGACCATCACTTCTCCACTG -3'

Sequencing Primer
(F):5'- ATGGCCATGTCTGCATAGC -3'
(R):5'- ACTCACCTGACTGGGGTCTG -3'
Posted On 2018-06-06