Incidental Mutation 'R6498:Fen1'
ID523123
Institutional Source Beutler Lab
Gene Symbol Fen1
Ensembl Gene ENSMUSG00000024742
Gene Nameflap structure specific endonuclease 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6498 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10199132-10204169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 10200115 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 322 (R322S)
Ref Sequence ENSEMBL: ENSMUSP00000117246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010807] [ENSMUST00000025651] [ENSMUST00000040372] [ENSMUST00000116542] [ENSMUST00000142241] [ENSMUST00000156291]
Predicted Effect probably benign
Transcript: ENSMUST00000010807
SMART Domains Protein: ENSMUSP00000010807
Gene: ENSMUSG00000010663

DomainStartEndE-ValueType
Cyt-b5 22 97 1.32e-19 SMART
transmembrane domain 134 156 N/A INTRINSIC
Pfam:FA_desaturase 158 421 7.4e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025651
AA Change: R322S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025651
Gene: ENSMUSG00000024742
AA Change: R322S

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040372
SMART Domains Protein: ENSMUSP00000044751
Gene: ENSMUSG00000036372

DomainStartEndE-ValueType
Pfam:UPF0197 3 79 3.3e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081739
Predicted Effect probably damaging
Transcript: ENSMUST00000116542
AA Change: R322S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112241
Gene: ENSMUSG00000024742
AA Change: R322S

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127878
Predicted Effect probably damaging
Transcript: ENSMUST00000142241
AA Change: R322S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119221
Gene: ENSMUSG00000024742
AA Change: R322S

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153854
Predicted Effect probably damaging
Transcript: ENSMUST00000156291
AA Change: R322S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117246
Gene: ENSMUSG00000024742
AA Change: R322S

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Meta Mutation Damage Score 0.332 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene removes 5' overhanging flaps in DNA repair and processes the 5' ends of Okazaki fragments in lagging strand DNA synthesis. Direct physical interaction between this protein and AP endonuclease 1 during long-patch base excision repair provides coordinated loading of the proteins onto the substrate, thus passing the substrate from one enzyme to another. The protein is a member of the XPG/RAD2 endonuclease family and is one of ten proteins essential for cell-free DNA replication. DNA secondary structure can inhibit flap processing at certain trinucleotide repeats in a length-dependent manner by concealing the 5' end of the flap that is necessary for both binding and cleavage by the protein encoded by this gene. Therefore, secondary structure can deter the protective function of this protein, leading to site-specific trinucleotide expansions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not form an inner cell mass, lack DNA synthesis in blastocyst giant cells and die by embryonic day 9.5. Embryonic day 3.5 blastocysts are hypersensitive to irradiation. Heterozygotes show enhanced adenocarcinoma susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T G 11: 110,292,102 N1043T possibly damaging Het
Actn2 C T 13: 12,276,473 E682K probably damaging Het
Agtpbp1 A G 13: 59,477,040 V833A possibly damaging Het
Arrb2 G T 11: 70,439,549 R333L probably benign Het
Atp9b C T 18: 80,777,015 S135N probably benign Het
Cep112 T A 11: 108,440,531 S135R probably benign Het
D630045J12Rik G A 6: 38,147,197 R1607* probably null Het
Duox1 A T 2: 122,319,607 S160C probably damaging Het
Eogt A T 6: 97,135,213 Y160N probably damaging Het
Exosc10 T C 4: 148,573,338 V647A probably benign Het
Fbxo44 C T 4: 148,154,425 Het
Gls A C 1: 52,220,039 N134K probably benign Het
Gm13212 T A 4: 145,622,889 C299S probably damaging Het
H2afy2 C A 10: 61,757,835 V21F probably damaging Het
Hspg2 T C 4: 137,507,801 V82A possibly damaging Het
Il33 G A 19: 29,949,737 E23K probably benign Het
Map2k5 C A 9: 63,286,401 A266S possibly damaging Het
Olfr309 T C 7: 86,307,018 I32V probably benign Het
Olfr329-ps T A 11: 58,542,582 N298I probably damaging Het
Olfr485 C T 7: 108,159,432 C147Y probably benign Het
Pcdh1 G A 18: 38,197,437 P838S probably benign Het
Pcdha5 A G 18: 36,962,715 E759G possibly damaging Het
Pclo T C 5: 14,669,491 I1214T unknown Het
Per3 T C 4: 151,029,205 I299V probably benign Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Synpo2 A T 3: 123,080,232 probably null Het
Sys1 G A 2: 164,464,518 A131T probably benign Het
Tekt2 A G 4: 126,324,305 L138P probably benign Het
Tmprss12 T A 15: 100,285,252 N158K probably damaging Het
Tnrc18 A T 5: 142,732,168 M2177K unknown Het
Trim43a T A 9: 88,582,342 I102N probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Utrn C T 10: 12,442,093 C498Y probably benign Het
Vmn1r39 A T 6: 66,804,857 V159D probably damaging Het
Vmn1r44 A G 6: 89,893,580 T103A probably benign Het
Wsb1 A T 11: 79,248,489 V127D probably damaging Het
Other mutations in Fen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02991:Fen1 UTSW 19 10200662 missense probably benign
R3161:Fen1 UTSW 19 10200291 missense probably damaging 0.96
R4245:Fen1 UTSW 19 10200367 missense probably damaging 0.99
R5481:Fen1 UTSW 19 10200658 missense probably damaging 1.00
R5553:Fen1 UTSW 19 10200423 missense probably benign
R5733:Fen1 UTSW 19 10200658 missense possibly damaging 0.86
R5783:Fen1 UTSW 19 10200830 nonsense probably null
R6244:Fen1 UTSW 19 10200687 missense probably damaging 1.00
R6797:Fen1 UTSW 19 10200703 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GAAGGACAGGTTTATTTTCCCCTTC -3'
(R):5'- TGTGGATCTGTGCATCCTGC -3'

Sequencing Primer
(F):5'- TCGGAACTTCCCCGCTC -3'
(R):5'- AGAGCATCCGTGGCATTG -3'
Posted On2018-06-06