Incidental Mutation 'R6561:Nostrin'
ID523125
Institutional Source Beutler Lab
Gene Symbol Nostrin
Ensembl Gene ENSMUSG00000034738
Gene Namenitric oxide synthase trafficker
SynonymsmDaIP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R6561 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location69135800-69189330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69180857 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 331 (A331T)
Ref Sequence ENSEMBL: ENSMUSP00000036923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041865]
Predicted Effect probably benign
Transcript: ENSMUST00000041865
AA Change: A331T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036923
Gene: ENSMUSG00000034738
AA Change: A331T

DomainStartEndE-ValueType
Pfam:FCH 13 88 4.9e-12 PFAM
low complexity region 135 146 N/A INTRINSIC
coiled coil region 160 190 N/A INTRINSIC
coiled coil region 305 334 N/A INTRINSIC
low complexity region 419 439 N/A INTRINSIC
SH3 441 496 8.89e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141276
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide (NO) is a potent mediator in biologic processes such as neurotransmission, inflammatory response, and vascular homeostasis. NOSTRIN binds the enzyme responsible for NO production, endothelial NO synthase (ENOS; MIM 163729), and triggers the translocation of ENOS from the plasma membrane to vesicle-like subcellular structures, thereby attenuating ENOS-dependent NO production.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired retinal vascular angiogenesis, endothelial cell proliferation, endothelial cell migration and induced neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,927,825 I468F probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Anapc1 A G 2: 128,663,999 V639A probably damaging Het
Cdh12 A G 15: 21,492,594 Y233C probably damaging Het
Dchs2 G T 3: 83,129,169 V408F probably benign Het
Dnmt3c T A 2: 153,720,030 L551Q probably damaging Het
Dock2 A G 11: 34,687,538 F746S probably damaging Het
Fastkd3 C T 13: 68,584,030 R157C possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ier3ip1 T A 18: 76,939,648 S58T probably damaging Het
Itpr2 A G 6: 146,234,006 V1809A probably damaging Het
Kif22 T A 7: 127,031,053 N437I probably benign Het
Klri1 A G 6: 129,717,001 V41A probably benign Het
Lrrc14 T A 15: 76,713,446 D125E possibly damaging Het
Nek10 A T 14: 14,828,448 N90I possibly damaging Het
Olfr1463 A G 19: 13,235,030 Y260C probably damaging Het
Olfr730 T C 14: 50,186,318 K300E probably damaging Het
Olfr870 T C 9: 20,170,777 T265A probably benign Het
Plxna1 A G 6: 89,356,978 V223A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Smg1 A T 7: 118,166,077 probably benign Het
Sorbs1 A G 19: 40,326,052 I772T probably benign Het
Sptbn2 A G 19: 4,747,926 N1927S probably benign Het
Tab1 T C 15: 80,148,830 V105A probably benign Het
Trbv15 A T 6: 41,141,480 T57S probably benign Het
Ttc37 T A 13: 76,150,519 S1115T probably damaging Het
Vmn1r78 A T 7: 12,152,899 I146F probably damaging Het
Vmn2r39 T A 7: 9,015,093 Y748F probably damaging Het
Zfp493 T A 13: 67,786,219 V65D possibly damaging Het
Other mutations in Nostrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nostrin APN 2 69185554 splice site probably benign
IGL00502:Nostrin APN 2 69183992 missense probably benign
IGL00767:Nostrin APN 2 69175775 missense probably benign 0.00
IGL00846:Nostrin APN 2 69185555 splice site probably benign
IGL00912:Nostrin APN 2 69182819 splice site probably benign
IGL02123:Nostrin APN 2 69156109 splice site probably benign
IGL02213:Nostrin APN 2 69183918 missense probably benign 0.25
R0295:Nostrin UTSW 2 69179416 missense probably benign 0.19
R0543:Nostrin UTSW 2 69189131 makesense probably null
R1384:Nostrin UTSW 2 69189062 missense probably benign 0.05
R1501:Nostrin UTSW 2 69158785 missense probably damaging 1.00
R1632:Nostrin UTSW 2 69175734 missense probably benign 0.21
R2012:Nostrin UTSW 2 69144767 splice site probably null
R2140:Nostrin UTSW 2 69166003 missense probably damaging 0.98
R2159:Nostrin UTSW 2 69180922 splice site probably null
R2329:Nostrin UTSW 2 69161094 missense probably damaging 1.00
R2890:Nostrin UTSW 2 69180905 missense probably benign
R4469:Nostrin UTSW 2 69175717 missense probably damaging 0.99
R4607:Nostrin UTSW 2 69183899 missense possibly damaging 0.89
R4608:Nostrin UTSW 2 69183899 missense possibly damaging 0.89
R4684:Nostrin UTSW 2 69183924 missense probably benign 0.00
R4719:Nostrin UTSW 2 69144812 nonsense probably null
R4846:Nostrin UTSW 2 69175579 missense probably damaging 1.00
R4911:Nostrin UTSW 2 69161142 missense possibly damaging 0.87
R4987:Nostrin UTSW 2 69156431 missense probably benign
R5054:Nostrin UTSW 2 69175713 missense possibly damaging 0.82
R5177:Nostrin UTSW 2 69175754 missense possibly damaging 0.83
R6785:Nostrin UTSW 2 69183927 missense probably benign 0.01
R6789:Nostrin UTSW 2 69175512 missense probably benign
R7453:Nostrin UTSW 2 69183896 missense possibly damaging 0.95
R7465:Nostrin UTSW 2 69185507 missense possibly damaging 0.93
R7570:Nostrin UTSW 2 69175806 missense probably damaging 0.98
R7761:Nostrin UTSW 2 69161122 missense possibly damaging 0.88
R7802:Nostrin UTSW 2 69189012 missense probably benign 0.18
X0021:Nostrin UTSW 2 69144792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTTCCTTAGCTGAGGGTGGC -3'
(R):5'- CACTCGATTGTTCTGAGTCAGG -3'

Sequencing Primer
(F):5'- GAGTAAGACTCTGTGACTCCTACAG -3'
(R):5'- CTCGATTGTTCTGAGTCAGGAGGAAG -3'
Posted On2018-06-06