Incidental Mutation 'R6561:Vmn2r39'
ID523134
Institutional Source Beutler Lab
Gene Symbol Vmn2r39
Ensembl Gene ENSMUSG00000096658
Gene Namevomeronasal 2, receptor 39
SynonymsEG545909
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6561 (G1)
Quality Score86.0076
Status Not validated
Chromosome7
Chromosomal Location9013875-9030798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9015093 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 748 (Y748F)
Ref Sequence ENSEMBL: ENSMUSP00000134010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174388]
Predicted Effect probably damaging
Transcript: ENSMUST00000174388
AA Change: Y748F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134010
Gene: ENSMUSG00000096658
AA Change: Y748F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 9.1e-32 PFAM
Pfam:NCD3G 512 565 7.9e-21 PFAM
Pfam:7tm_3 598 833 2.6e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,927,825 I468F probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Anapc1 A G 2: 128,663,999 V639A probably damaging Het
Cdh12 A G 15: 21,492,594 Y233C probably damaging Het
Dchs2 G T 3: 83,129,169 V408F probably benign Het
Dnmt3c T A 2: 153,720,030 L551Q probably damaging Het
Dock2 A G 11: 34,687,538 F746S probably damaging Het
Fastkd3 C T 13: 68,584,030 R157C possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ier3ip1 T A 18: 76,939,648 S58T probably damaging Het
Itpr2 A G 6: 146,234,006 V1809A probably damaging Het
Kif22 T A 7: 127,031,053 N437I probably benign Het
Klri1 A G 6: 129,717,001 V41A probably benign Het
Lrrc14 T A 15: 76,713,446 D125E possibly damaging Het
Nek10 A T 14: 14,828,448 N90I possibly damaging Het
Nostrin G A 2: 69,180,857 A331T probably benign Het
Olfr1463 A G 19: 13,235,030 Y260C probably damaging Het
Olfr730 T C 14: 50,186,318 K300E probably damaging Het
Olfr870 T C 9: 20,170,777 T265A probably benign Het
Plxna1 A G 6: 89,356,978 V223A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Smg1 A T 7: 118,166,077 probably benign Het
Sorbs1 A G 19: 40,326,052 I772T probably benign Het
Sptbn2 A G 19: 4,747,926 N1927S probably benign Het
Tab1 T C 15: 80,148,830 V105A probably benign Het
Trbv15 A T 6: 41,141,480 T57S probably benign Het
Ttc37 T A 13: 76,150,519 S1115T probably damaging Het
Vmn1r78 A T 7: 12,152,899 I146F probably damaging Het
Zfp493 T A 13: 67,786,219 V65D possibly damaging Het
Other mutations in Vmn2r39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Vmn2r39 APN 7 9023644 missense probably benign 0.19
IGL03017:Vmn2r39 APN 7 9014941 missense probably damaging 1.00
R1314:Vmn2r39 UTSW 7 9014982 missense probably damaging 1.00
R1358:Vmn2r39 UTSW 7 9023688 missense possibly damaging 0.63
R1480:Vmn2r39 UTSW 7 9014956 missense probably damaging 1.00
R4119:Vmn2r39 UTSW 7 9023674 missense probably benign 0.01
R4120:Vmn2r39 UTSW 7 9023674 missense probably benign 0.01
R4720:Vmn2r39 UTSW 7 9023470 critical splice donor site probably null
R4990:Vmn2r39 UTSW 7 9023676 missense probably benign
R5079:Vmn2r39 UTSW 7 9023490 missense probably benign 0.05
R5695:Vmn2r39 UTSW 7 9025151 missense possibly damaging 0.87
R6131:Vmn2r39 UTSW 7 9014964 missense probably damaging 1.00
R7108:Vmn2r39 UTSW 7 9023668 missense probably damaging 0.96
R7122:Vmn2r39 UTSW 7 9014762 missense possibly damaging 0.72
Z1176:Vmn2r39 UTSW 7 9015033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCATGACCTTGCCCTTG -3'
(R):5'- TGTGGTTCTCGCCTTCAAAG -3'

Sequencing Primer
(F):5'- CCCTTGGTGCTATGGTAGACAG -3'
(R):5'- GGTTCTCGCCTTCAAAGTCACAG -3'
Posted On2018-06-06