Incidental Mutation 'R6561:Vmn1r78'
ID523135
Institutional Source Beutler Lab
Gene Symbol Vmn1r78
Ensembl Gene ENSMUSG00000061602
Gene Namevomeronasal 1 receptor 78
SynonymsV1rg7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6561 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12150257-12159959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12152899 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 146 (I146F)
Ref Sequence ENSEMBL: ENSMUSP00000154797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078039] [ENSMUST00000228244] [ENSMUST00000228664]
Predicted Effect probably damaging
Transcript: ENSMUST00000078039
AA Change: I146F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077186
Gene: ENSMUSG00000061602
AA Change: I146F

DomainStartEndE-ValueType
Pfam:TAS2R 3 304 5.7e-8 PFAM
Pfam:V1R 12 301 1.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209489
Predicted Effect probably damaging
Transcript: ENSMUST00000228244
AA Change: I146F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228664
AA Change: I146F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,927,825 I468F probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Anapc1 A G 2: 128,663,999 V639A probably damaging Het
Cdh12 A G 15: 21,492,594 Y233C probably damaging Het
Dchs2 G T 3: 83,129,169 V408F probably benign Het
Dnmt3c T A 2: 153,720,030 L551Q probably damaging Het
Dock2 A G 11: 34,687,538 F746S probably damaging Het
Fastkd3 C T 13: 68,584,030 R157C possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ier3ip1 T A 18: 76,939,648 S58T probably damaging Het
Itpr2 A G 6: 146,234,006 V1809A probably damaging Het
Kif22 T A 7: 127,031,053 N437I probably benign Het
Klri1 A G 6: 129,717,001 V41A probably benign Het
Lrrc14 T A 15: 76,713,446 D125E possibly damaging Het
Nek10 A T 14: 14,828,448 N90I possibly damaging Het
Nostrin G A 2: 69,180,857 A331T probably benign Het
Olfr1463 A G 19: 13,235,030 Y260C probably damaging Het
Olfr730 T C 14: 50,186,318 K300E probably damaging Het
Olfr870 T C 9: 20,170,777 T265A probably benign Het
Plxna1 A G 6: 89,356,978 V223A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Smg1 A T 7: 118,166,077 probably benign Het
Sorbs1 A G 19: 40,326,052 I772T probably benign Het
Sptbn2 A G 19: 4,747,926 N1927S probably benign Het
Tab1 T C 15: 80,148,830 V105A probably benign Het
Trbv15 A T 6: 41,141,480 T57S probably benign Het
Ttc37 T A 13: 76,150,519 S1115T probably damaging Het
Vmn2r39 T A 7: 9,015,093 Y748F probably damaging Het
Zfp493 T A 13: 67,786,219 V65D possibly damaging Het
Other mutations in Vmn1r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Vmn1r78 APN 7 12153238 missense probably benign 0.10
IGL02019:Vmn1r78 APN 7 12152707 missense probably damaging 0.99
IGL02143:Vmn1r78 APN 7 12152480 missense probably benign
IGL02154:Vmn1r78 APN 7 12152545 missense probably benign 0.22
IGL02290:Vmn1r78 APN 7 12153155 missense probably damaging 1.00
IGL03012:Vmn1r78 APN 7 12153364 missense probably benign 0.32
IGL03256:Vmn1r78 APN 7 12152798 missense probably damaging 1.00
IGL03373:Vmn1r78 APN 7 12153343 missense possibly damaging 0.86
IGL03384:Vmn1r78 APN 7 12153209 missense possibly damaging 0.94
R0016:Vmn1r78 UTSW 7 12153352 missense probably benign 0.02
R1445:Vmn1r78 UTSW 7 12152581 missense possibly damaging 0.64
R1748:Vmn1r78 UTSW 7 12153323 missense probably damaging 1.00
R2017:Vmn1r78 UTSW 7 12153343 missense possibly damaging 0.86
R2032:Vmn1r78 UTSW 7 12153283 missense probably benign 0.00
R2198:Vmn1r78 UTSW 7 12152560 missense probably benign 0.06
R4330:Vmn1r78 UTSW 7 12152459 unclassified probably null
R4564:Vmn1r78 UTSW 7 12152558 missense probably damaging 1.00
R4769:Vmn1r78 UTSW 7 12152798 missense probably damaging 1.00
R4801:Vmn1r78 UTSW 7 12152964 nonsense probably null
R4802:Vmn1r78 UTSW 7 12152964 nonsense probably null
R4860:Vmn1r78 UTSW 7 12152756 missense probably damaging 1.00
R4860:Vmn1r78 UTSW 7 12152756 missense probably damaging 1.00
R5648:Vmn1r78 UTSW 7 12152766 missense possibly damaging 0.92
R6869:Vmn1r78 UTSW 7 12152749 missense probably benign 0.01
R6945:Vmn1r78 UTSW 7 12152905 missense probably benign 0.01
R7793:Vmn1r78 UTSW 7 12153314 missense probably benign 0.01
Z1088:Vmn1r78 UTSW 7 12152714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGACACTGTCAGATTTGG -3'
(R):5'- ACTTGAGCAGGCCATGAGAC -3'

Sequencing Primer
(F):5'- CCTGGATGATATTGGTTGTAAATTGG -3'
(R):5'- AGGCCATGAGACCCAGG -3'
Posted On2018-06-06