Incidental Mutation 'R6561:Kif22'
ID523138
Institutional Source Beutler Lab
Gene Symbol Kif22
Ensembl Gene ENSMUSG00000030677
Gene Namekinesin family member 22
SynonymsKid, Kif22a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6561 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127027729-127042471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127031053 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 437 (N437I)
Ref Sequence ENSEMBL: ENSMUSP00000032915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032915] [ENSMUST00000032916] [ENSMUST00000205461] [ENSMUST00000205568] [ENSMUST00000205806] [ENSMUST00000206254] [ENSMUST00000206291]
Predicted Effect probably benign
Transcript: ENSMUST00000032915
AA Change: N437I

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032915
Gene: ENSMUSG00000030677
AA Change: N437I

DomainStartEndE-ValueType
KISc 36 371 1.12e-140 SMART
low complexity region 399 428 N/A INTRINSIC
coiled coil region 460 496 N/A INTRINSIC
HhH1 597 616 2.16e0 SMART
HhH1 627 646 8.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032916
SMART Domains Protein: ENSMUSP00000032916
Gene: ENSMUSG00000030678

DomainStartEndE-ValueType
low complexity region 59 82 N/A INTRINSIC
low complexity region 90 126 N/A INTRINSIC
low complexity region 130 179 N/A INTRINSIC
ZnF_C2H2 190 212 4.11e-2 SMART
low complexity region 231 272 N/A INTRINSIC
ZnF_C2H2 279 301 6.78e-3 SMART
ZnF_C2H2 307 329 4.87e-4 SMART
ZnF_C2H2 337 360 1.22e-4 SMART
ZnF_C2H2 366 388 1.79e-2 SMART
ZnF_C2H2 392 413 6.57e0 SMART
low complexity region 435 451 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205461
Predicted Effect probably benign
Transcript: ENSMUST00000205568
Predicted Effect probably benign
Transcript: ENSMUST00000205754
Predicted Effect probably benign
Transcript: ENSMUST00000205806
Predicted Effect probably benign
Transcript: ENSMUST00000206254
Predicted Effect probably benign
Transcript: ENSMUST00000206291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206924
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. The C-terminal half of this protein has been shown to bind DNA. Studies with the Xenopus homolog suggests its essential role in metaphase chromosome alignment and maintenance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to implantation due to defective meiosis II and early embryo mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,927,825 I468F probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Anapc1 A G 2: 128,663,999 V639A probably damaging Het
Cdh12 A G 15: 21,492,594 Y233C probably damaging Het
Dchs2 G T 3: 83,129,169 V408F probably benign Het
Dnmt3c T A 2: 153,720,030 L551Q probably damaging Het
Dock2 A G 11: 34,687,538 F746S probably damaging Het
Fastkd3 C T 13: 68,584,030 R157C possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ier3ip1 T A 18: 76,939,648 S58T probably damaging Het
Itpr2 A G 6: 146,234,006 V1809A probably damaging Het
Klri1 A G 6: 129,717,001 V41A probably benign Het
Lrrc14 T A 15: 76,713,446 D125E possibly damaging Het
Nek10 A T 14: 14,828,448 N90I possibly damaging Het
Nostrin G A 2: 69,180,857 A331T probably benign Het
Olfr1463 A G 19: 13,235,030 Y260C probably damaging Het
Olfr730 T C 14: 50,186,318 K300E probably damaging Het
Olfr870 T C 9: 20,170,777 T265A probably benign Het
Plxna1 A G 6: 89,356,978 V223A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Smg1 A T 7: 118,166,077 probably benign Het
Sorbs1 A G 19: 40,326,052 I772T probably benign Het
Sptbn2 A G 19: 4,747,926 N1927S probably benign Het
Tab1 T C 15: 80,148,830 V105A probably benign Het
Trbv15 A T 6: 41,141,480 T57S probably benign Het
Ttc37 T A 13: 76,150,519 S1115T probably damaging Het
Vmn1r78 A T 7: 12,152,899 I146F probably damaging Het
Vmn2r39 T A 7: 9,015,093 Y748F probably damaging Het
Zfp493 T A 13: 67,786,219 V65D possibly damaging Het
Other mutations in Kif22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Kif22 APN 7 127033473 missense probably damaging 0.96
IGL01333:Kif22 APN 7 127034195 missense probably damaging 1.00
R0207:Kif22 UTSW 7 127042400 start codon destroyed probably null 0.73
R0723:Kif22 UTSW 7 127033906 missense probably damaging 1.00
R1118:Kif22 UTSW 7 127032744 missense probably benign
R1521:Kif22 UTSW 7 127027839 missense probably damaging 0.99
R2036:Kif22 UTSW 7 127030954 missense possibly damaging 0.94
R2092:Kif22 UTSW 7 127033630 missense probably damaging 0.99
R3790:Kif22 UTSW 7 127029496 missense probably damaging 1.00
R4587:Kif22 UTSW 7 127032880 critical splice donor site probably null
R4667:Kif22 UTSW 7 127033328 missense probably damaging 1.00
R5082:Kif22 UTSW 7 127033377 missense possibly damaging 0.71
R5853:Kif22 UTSW 7 127033367 missense possibly damaging 0.92
R6045:Kif22 UTSW 7 127031078 missense probably benign 0.00
R6175:Kif22 UTSW 7 127031056 missense possibly damaging 0.53
R6195:Kif22 UTSW 7 127028959 missense probably damaging 0.99
R6407:Kif22 UTSW 7 127033203 missense probably damaging 1.00
R6416:Kif22 UTSW 7 127028932 missense possibly damaging 0.95
R7122:Kif22 UTSW 7 127032978 missense probably benign 0.01
R7644:Kif22 UTSW 7 127032962 missense probably damaging 1.00
R8143:Kif22 UTSW 7 127033225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGTCTGAAGATACTAGGAATGC -3'
(R):5'- CCCTGAGAGTTTACTTCACCTG -3'

Sequencing Primer
(F):5'- TGAGCACCATTCGTTCTC -3'
(R):5'- GAGAGTTTACTTCACCTGAAAAAGAC -3'
Posted On2018-06-06