Incidental Mutation 'R6561:Zfp493'
ID523142
Institutional Source Beutler Lab
Gene Symbol Zfp493
Ensembl Gene ENSMUSG00000090659
Gene Namezinc finger protein 493
Synonyms2900054J07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6561 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67779693-67792512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67786219 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 65 (V65D)
Ref Sequence ENSEMBL: ENSMUSP00000152847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164936] [ENSMUST00000181319] [ENSMUST00000220570]
Predicted Effect probably benign
Transcript: ENSMUST00000164936
AA Change: V97D

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132282
Gene: ENSMUSG00000090659
AA Change: V97D

DomainStartEndE-ValueType
KRAB 5 65 3.47e-32 SMART
ZnF_C2H2 81 103 2.27e-4 SMART
ZnF_C2H2 109 131 3.95e-4 SMART
ZnF_C2H2 137 159 7.37e-4 SMART
ZnF_C2H2 165 187 6.32e-3 SMART
ZnF_C2H2 193 215 2.99e-4 SMART
ZnF_C2H2 221 243 9.73e-4 SMART
ZnF_C2H2 249 271 2.57e-3 SMART
ZnF_C2H2 277 299 1.53e-1 SMART
ZnF_C2H2 305 327 1.1e-2 SMART
ZnF_C2H2 333 355 5.42e-2 SMART
ZnF_C2H2 361 383 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180507
Predicted Effect probably benign
Transcript: ENSMUST00000181319
SMART Domains Protein: ENSMUSP00000137936
Gene: ENSMUSG00000090659

DomainStartEndE-ValueType
KRAB 5 65 3.47e-32 SMART
low complexity region 80 88 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220570
AA Change: V65D

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223540
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,927,825 I468F probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Anapc1 A G 2: 128,663,999 V639A probably damaging Het
Cdh12 A G 15: 21,492,594 Y233C probably damaging Het
Dchs2 G T 3: 83,129,169 V408F probably benign Het
Dnmt3c T A 2: 153,720,030 L551Q probably damaging Het
Dock2 A G 11: 34,687,538 F746S probably damaging Het
Fastkd3 C T 13: 68,584,030 R157C possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ier3ip1 T A 18: 76,939,648 S58T probably damaging Het
Itpr2 A G 6: 146,234,006 V1809A probably damaging Het
Kif22 T A 7: 127,031,053 N437I probably benign Het
Klri1 A G 6: 129,717,001 V41A probably benign Het
Lrrc14 T A 15: 76,713,446 D125E possibly damaging Het
Nek10 A T 14: 14,828,448 N90I possibly damaging Het
Nostrin G A 2: 69,180,857 A331T probably benign Het
Olfr1463 A G 19: 13,235,030 Y260C probably damaging Het
Olfr730 T C 14: 50,186,318 K300E probably damaging Het
Olfr870 T C 9: 20,170,777 T265A probably benign Het
Plxna1 A G 6: 89,356,978 V223A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Smg1 A T 7: 118,166,077 probably benign Het
Sorbs1 A G 19: 40,326,052 I772T probably benign Het
Sptbn2 A G 19: 4,747,926 N1927S probably benign Het
Tab1 T C 15: 80,148,830 V105A probably benign Het
Trbv15 A T 6: 41,141,480 T57S probably benign Het
Ttc37 T A 13: 76,150,519 S1115T probably damaging Het
Vmn1r78 A T 7: 12,152,899 I146F probably damaging Het
Vmn2r39 T A 7: 9,015,093 Y748F probably damaging Het
Other mutations in Zfp493
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Zfp493 APN 13 67786802 missense probably benign 0.06
IGL02367:Zfp493 APN 13 67786970 nonsense probably null
R0647:Zfp493 UTSW 13 67783875 missense possibly damaging 0.92
R1478:Zfp493 UTSW 13 67786561 missense probably damaging 1.00
R1617:Zfp493 UTSW 13 67783880 missense probably damaging 1.00
R1990:Zfp493 UTSW 13 67786269 missense probably damaging 1.00
R4007:Zfp493 UTSW 13 67783919 splice site probably benign
R4700:Zfp493 UTSW 13 67786617 missense probably damaging 1.00
R4782:Zfp493 UTSW 13 67786203 missense probably null 0.97
R5376:Zfp493 UTSW 13 67786318 missense possibly damaging 0.81
R5395:Zfp493 UTSW 13 67783846 nonsense probably null
R5909:Zfp493 UTSW 13 67786598 nonsense probably null
R6066:Zfp493 UTSW 13 67786950 missense possibly damaging 0.90
R6419:Zfp493 UTSW 13 67786407 missense probably benign 0.16
R6625:Zfp493 UTSW 13 67786395 nonsense probably null
R6714:Zfp493 UTSW 13 67786380 missense probably benign 0.06
R7678:Zfp493 UTSW 13 67779695 start gained probably benign
R7782:Zfp493 UTSW 13 67787004 missense probably benign 0.31
R8262:Zfp493 UTSW 13 67786857 missense probably damaging 1.00
R8317:Zfp493 UTSW 13 67783839 missense probably benign 0.42
X0021:Zfp493 UTSW 13 67786378 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTGTGAAGGTGTCAGATCTC -3'
(R):5'- TATGGATTCTTTGATGCTTACCCAG -3'

Sequencing Primer
(F):5'- AGGTGTCAGATCTCCTGGAAC -3'
(R):5'- TGCCACACACTTCACATTTGTAAGG -3'
Posted On2018-06-06