Incidental Mutation 'R6561:Olfr730'
ID523146
Institutional Source Beutler Lab
Gene Symbol Olfr730
Ensembl Gene ENSMUSG00000109835
Gene Nameolfactory receptor 730
SynonymsGA_x6K02T2PMLR-5881670-5880717, MOR247-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R6561 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50183296-50188198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50186318 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 300 (K300E)
Ref Sequence ENSEMBL: ENSMUSP00000145742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051453] [ENSMUST00000205837]
Predicted Effect probably damaging
Transcript: ENSMUST00000051453
AA Change: K301E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060325
Gene: ENSMUSG00000109835
AA Change: K301E

DomainStartEndE-ValueType
Pfam:7tm_4 32 305 3.4e-44 PFAM
Pfam:7tm_1 42 288 1.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205837
AA Change: K300E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215779
Meta Mutation Damage Score 0.1594 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,927,825 I468F probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Anapc1 A G 2: 128,663,999 V639A probably damaging Het
Cdh12 A G 15: 21,492,594 Y233C probably damaging Het
Dchs2 G T 3: 83,129,169 V408F probably benign Het
Dnmt3c T A 2: 153,720,030 L551Q probably damaging Het
Dock2 A G 11: 34,687,538 F746S probably damaging Het
Fastkd3 C T 13: 68,584,030 R157C possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ier3ip1 T A 18: 76,939,648 S58T probably damaging Het
Itpr2 A G 6: 146,234,006 V1809A probably damaging Het
Kif22 T A 7: 127,031,053 N437I probably benign Het
Klri1 A G 6: 129,717,001 V41A probably benign Het
Lrrc14 T A 15: 76,713,446 D125E possibly damaging Het
Nek10 A T 14: 14,828,448 N90I possibly damaging Het
Nostrin G A 2: 69,180,857 A331T probably benign Het
Olfr1463 A G 19: 13,235,030 Y260C probably damaging Het
Olfr870 T C 9: 20,170,777 T265A probably benign Het
Plxna1 A G 6: 89,356,978 V223A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Smg1 A T 7: 118,166,077 probably benign Het
Sorbs1 A G 19: 40,326,052 I772T probably benign Het
Sptbn2 A G 19: 4,747,926 N1927S probably benign Het
Tab1 T C 15: 80,148,830 V105A probably benign Het
Trbv15 A T 6: 41,141,480 T57S probably benign Het
Ttc37 T A 13: 76,150,519 S1115T probably damaging Het
Vmn1r78 A T 7: 12,152,899 I146F probably damaging Het
Vmn2r39 T A 7: 9,015,093 Y748F probably damaging Het
Zfp493 T A 13: 67,786,219 V65D possibly damaging Het
Other mutations in Olfr730
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01998:Olfr730 APN 14 50186648 missense probably benign 0.36
IGL02976:Olfr730 APN 14 50186432 nonsense probably null
IGL03065:Olfr730 APN 14 50187008 missense probably damaging 1.00
IGL03122:Olfr730 APN 14 50187004 missense probably damaging 0.98
R0277:Olfr730 UTSW 14 50186332 missense probably null 0.06
R1081:Olfr730 UTSW 14 50187197 missense probably damaging 1.00
R1189:Olfr730 UTSW 14 50187082 missense probably damaging 0.99
R1501:Olfr730 UTSW 14 50187082 missense probably damaging 0.99
R2680:Olfr730 UTSW 14 50186847 nonsense probably null
R2869:Olfr730 UTSW 14 50186354 missense probably benign 0.08
R2869:Olfr730 UTSW 14 50186354 missense probably benign 0.08
R3415:Olfr730 UTSW 14 50186612 missense possibly damaging 0.60
R3417:Olfr730 UTSW 14 50186612 missense possibly damaging 0.60
R3721:Olfr730 UTSW 14 50186680 missense probably damaging 1.00
R4864:Olfr730 UTSW 14 50186582 missense probably damaging 0.97
R5037:Olfr730 UTSW 14 50186288 missense probably benign 0.00
R5349:Olfr730 UTSW 14 50186773 nonsense probably null
R5738:Olfr730 UTSW 14 50186648 missense probably benign 0.09
R5779:Olfr730 UTSW 14 50186746 missense possibly damaging 0.82
R5853:Olfr730 UTSW 14 50186869 missense possibly damaging 0.88
R5918:Olfr730 UTSW 14 50186968 missense probably benign
R6166:Olfr730 UTSW 14 50186768 missense probably benign
R6196:Olfr730 UTSW 14 50186678 missense probably damaging 1.00
R6218:Olfr730 UTSW 14 50186678 missense probably damaging 1.00
R6220:Olfr730 UTSW 14 50186678 missense probably damaging 1.00
R6798:Olfr730 UTSW 14 50187127 missense probably benign 0.00
R6834:Olfr730 UTSW 14 50186483 missense probably benign 0.12
R7174:Olfr730 UTSW 14 50186696 missense probably benign 0.00
R7406:Olfr730 UTSW 14 50186558 missense probably damaging 0.97
R7592:Olfr730 UTSW 14 50186563 missense probably damaging 1.00
R7886:Olfr730 UTSW 14 50186564 missense probably damaging 1.00
R7969:Olfr730 UTSW 14 50186564 missense probably damaging 1.00
X0023:Olfr730 UTSW 14 50187201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGGCATCATTACCCGTAATC -3'
(R):5'- GTACAGCCCACTTCATCGTTG -3'

Sequencing Primer
(F):5'- GGCATCATTACCCGTAATCATTAGTC -3'
(R):5'- GTCTTCATGTTCTTTGGGCCATG -3'
Posted On2018-06-06