Incidental Mutation 'R6561:Cdh12'
ID523147
Institutional Source Beutler Lab
Gene Symbol Cdh12
Ensembl Gene ENSMUSG00000040452
Gene Namecadherin 12
SynonymsBr-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R6561 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location20449265-21589533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21492594 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 233 (Y233C)
Ref Sequence ENSEMBL: ENSMUSP00000153750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075132] [ENSMUST00000227496]
Predicted Effect probably damaging
Transcript: ENSMUST00000075132
AA Change: Y233C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074632
Gene: ENSMUSG00000040452
AA Change: Y233C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 77 158 5.18e-18 SMART
CA 182 267 4.4e-30 SMART
CA 291 383 2.42e-18 SMART
CA 406 487 7.55e-20 SMART
CA 510 597 9.3e-2 SMART
transmembrane domain 615 637 N/A INTRINSIC
Pfam:Cadherin_C 640 784 1.7e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227496
AA Change: Y233C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in both the excitatory and inhibitory neurons in various areas of the adult central nervous system including the cerebellum, neocortex, hippocampus and in different subcortical nuclei. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,927,825 I468F probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Anapc1 A G 2: 128,663,999 V639A probably damaging Het
Dchs2 G T 3: 83,129,169 V408F probably benign Het
Dnmt3c T A 2: 153,720,030 L551Q probably damaging Het
Dock2 A G 11: 34,687,538 F746S probably damaging Het
Fastkd3 C T 13: 68,584,030 R157C possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ier3ip1 T A 18: 76,939,648 S58T probably damaging Het
Itpr2 A G 6: 146,234,006 V1809A probably damaging Het
Kif22 T A 7: 127,031,053 N437I probably benign Het
Klri1 A G 6: 129,717,001 V41A probably benign Het
Lrrc14 T A 15: 76,713,446 D125E possibly damaging Het
Nek10 A T 14: 14,828,448 N90I possibly damaging Het
Nostrin G A 2: 69,180,857 A331T probably benign Het
Olfr1463 A G 19: 13,235,030 Y260C probably damaging Het
Olfr730 T C 14: 50,186,318 K300E probably damaging Het
Olfr870 T C 9: 20,170,777 T265A probably benign Het
Plxna1 A G 6: 89,356,978 V223A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Smg1 A T 7: 118,166,077 probably benign Het
Sorbs1 A G 19: 40,326,052 I772T probably benign Het
Sptbn2 A G 19: 4,747,926 N1927S probably benign Het
Tab1 T C 15: 80,148,830 V105A probably benign Het
Trbv15 A T 6: 41,141,480 T57S probably benign Het
Ttc37 T A 13: 76,150,519 S1115T probably damaging Het
Vmn1r78 A T 7: 12,152,899 I146F probably damaging Het
Vmn2r39 T A 7: 9,015,093 Y748F probably damaging Het
Zfp493 T A 13: 67,786,219 V65D possibly damaging Het
Other mutations in Cdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Cdh12 APN 15 21237903 missense probably damaging 0.98
IGL01414:Cdh12 APN 15 21492689 missense probably damaging 1.00
IGL02088:Cdh12 APN 15 21480339 nonsense probably null
IGL02894:Cdh12 APN 15 21586294 missense probably damaging 1.00
IGL03008:Cdh12 APN 15 21480330 missense probably damaging 0.98
IGL03271:Cdh12 APN 15 21586453 missense probably benign 0.19
IGL03402:Cdh12 APN 15 21583740 missense probably benign 0.08
R0042:Cdh12 UTSW 15 21537677 splice site probably benign
R0126:Cdh12 UTSW 15 21583945 missense probably benign
R0239:Cdh12 UTSW 15 21586407 missense probably damaging 1.00
R0239:Cdh12 UTSW 15 21586407 missense probably damaging 1.00
R0335:Cdh12 UTSW 15 21578549 critical splice donor site probably null
R0421:Cdh12 UTSW 15 21480224 critical splice acceptor site probably null
R0918:Cdh12 UTSW 15 21492599 missense probably damaging 0.99
R0972:Cdh12 UTSW 15 21237764 missense probably benign 0.27
R1014:Cdh12 UTSW 15 21492620 missense probably damaging 0.97
R1304:Cdh12 UTSW 15 21583937 missense probably benign 0.10
R1677:Cdh12 UTSW 15 21520405 missense probably damaging 0.99
R1735:Cdh12 UTSW 15 21520366 missense probably damaging 1.00
R1916:Cdh12 UTSW 15 21520250 splice site probably null
R1950:Cdh12 UTSW 15 21237879 missense probably damaging 1.00
R2059:Cdh12 UTSW 15 21583740 missense probably benign 0.08
R2157:Cdh12 UTSW 15 21583787 missense possibly damaging 0.84
R2404:Cdh12 UTSW 15 21537634 missense probably damaging 1.00
R3625:Cdh12 UTSW 15 21358756 missense probably damaging 1.00
R3703:Cdh12 UTSW 15 21583826 missense probably damaging 0.97
R3704:Cdh12 UTSW 15 21583826 missense probably damaging 0.97
R3743:Cdh12 UTSW 15 21537659 missense probably damaging 0.98
R3771:Cdh12 UTSW 15 21578554 splice site probably benign
R3780:Cdh12 UTSW 15 21585977 splice site probably null
R4750:Cdh12 UTSW 15 21583808 missense possibly damaging 0.59
R5373:Cdh12 UTSW 15 21583912 missense probably damaging 1.00
R5374:Cdh12 UTSW 15 21583912 missense probably damaging 1.00
R5443:Cdh12 UTSW 15 21237849 missense probably benign 0.01
R5548:Cdh12 UTSW 15 21492654 missense probably damaging 1.00
R5746:Cdh12 UTSW 15 21358724 missense probably null 1.00
R5960:Cdh12 UTSW 15 21492476 intron probably null
R6248:Cdh12 UTSW 15 21237714 missense possibly damaging 0.82
R6379:Cdh12 UTSW 15 21492657 missense probably benign 0.02
R6419:Cdh12 UTSW 15 21520397 missense probably damaging 0.99
R6901:Cdh12 UTSW 15 21583786 missense probably benign 0.01
R7025:Cdh12 UTSW 15 21358814 missense probably damaging 1.00
R7070:Cdh12 UTSW 15 21583829 missense probably benign 0.38
R7508:Cdh12 UTSW 15 21583765 missense probably benign
R8126:Cdh12 UTSW 15 21558307 missense probably benign 0.02
R8307:Cdh12 UTSW 15 21358863 missense probably benign
R8307:Cdh12 UTSW 15 21358864 missense probably damaging 1.00
X0065:Cdh12 UTSW 15 21358765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTTACTGTACGGTGGTGAAAAC -3'
(R):5'- GATGGCTCAATTCTCTTTCTAGAC -3'

Sequencing Primer
(F):5'- TTACTGTACGGTGGTGAAAACAAAAG -3'
(R):5'- CGCATTTGCAAACATGCTTAACAGG -3'
Posted On2018-06-06