Incidental Mutation 'R6561:Tab1'
ID523149
Institutional Source Beutler Lab
Gene Symbol Tab1
Ensembl Gene ENSMUSG00000022414
Gene NameTGF-beta activated kinase 1/MAP3K7 binding protein 1
Synonyms2310012M03Rik, Map3k7ip1, b2b449Clo, Tak1-binding protein 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6561 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location80133127-80161707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80148830 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 105 (V105A)
Ref Sequence ENSEMBL: ENSMUSP00000023050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023050] [ENSMUST00000229320]
PDB Structure
Structural basis of autoactivation of p38 alpha induced by TAB1 (Monoclinic crystal form) [X-RAY DIFFRACTION]
Structural basis of autoactivation of p38 alpha induced by TAB1 (Tetragonal crystal form) [X-RAY DIFFRACTION]
Structural basis of autoactivation of p38 alpha induced by TAB1 (Tetragonal crystal form with bound sulphate) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000023050
AA Change: V105A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023050
Gene: ENSMUSG00000022414
AA Change: V105A

DomainStartEndE-ValueType
PP2Cc 26 363 7.45e-40 SMART
low complexity region 397 408 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
PDB:4L3P|A 466 502 6e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000229320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230479
Meta Mutation Damage Score 0.1951 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a regulator of the MAP kinase kinase kinase MAP3K7/TAK1, which is known to mediate various intracellular signaling pathways, such as those induced by TGF beta, interleukin 1, and WNT-1. This protein interacts and thus activates TAK1 kinase. It has been shown that the C-terminal portion of this protein is sufficient for binding and activation of TAK1, while a portion of the N-terminus acts as a dominant-negative inhibitor of TGF beta, suggesting that this protein may function as a mediator between TGF beta receptors and TAK1. This protein can also interact with and activate the mitogen-activated protein kinase 14 (MAPK14/p38alpha), and thus represents an alternative activation pathway, in addition to the MAPKK pathways, which contributes to the biological responses of MAPK14 to various stimuli. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant fetuses exhibit edema, hemorrhaging, cardiovascular and pulmonary dysmorphogenesis, and die in the late stages of gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,927,825 I468F probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Anapc1 A G 2: 128,663,999 V639A probably damaging Het
Cdh12 A G 15: 21,492,594 Y233C probably damaging Het
Dchs2 G T 3: 83,129,169 V408F probably benign Het
Dnmt3c T A 2: 153,720,030 L551Q probably damaging Het
Dock2 A G 11: 34,687,538 F746S probably damaging Het
Fastkd3 C T 13: 68,584,030 R157C possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ier3ip1 T A 18: 76,939,648 S58T probably damaging Het
Itpr2 A G 6: 146,234,006 V1809A probably damaging Het
Kif22 T A 7: 127,031,053 N437I probably benign Het
Klri1 A G 6: 129,717,001 V41A probably benign Het
Lrrc14 T A 15: 76,713,446 D125E possibly damaging Het
Nek10 A T 14: 14,828,448 N90I possibly damaging Het
Nostrin G A 2: 69,180,857 A331T probably benign Het
Olfr1463 A G 19: 13,235,030 Y260C probably damaging Het
Olfr730 T C 14: 50,186,318 K300E probably damaging Het
Olfr870 T C 9: 20,170,777 T265A probably benign Het
Plxna1 A G 6: 89,356,978 V223A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Smg1 A T 7: 118,166,077 probably benign Het
Sorbs1 A G 19: 40,326,052 I772T probably benign Het
Sptbn2 A G 19: 4,747,926 N1927S probably benign Het
Trbv15 A T 6: 41,141,480 T57S probably benign Het
Ttc37 T A 13: 76,150,519 S1115T probably damaging Het
Vmn1r78 A T 7: 12,152,899 I146F probably damaging Het
Vmn2r39 T A 7: 9,015,093 Y748F probably damaging Het
Zfp493 T A 13: 67,786,219 V65D possibly damaging Het
Other mutations in Tab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02686:Tab1 APN 15 80148830 missense probably benign 0.05
memento UTSW 15 80153668 missense probably damaging 0.96
Memoir UTSW 15 80153740 missense probably damaging 1.00
R0085:Tab1 UTSW 15 80155893 missense probably benign 0.00
R1341:Tab1 UTSW 15 80160114 missense possibly damaging 0.86
R1835:Tab1 UTSW 15 80148296 missense probably benign 0.42
R1907:Tab1 UTSW 15 80153668 missense probably damaging 0.96
R3113:Tab1 UTSW 15 80148260 missense probably benign 0.23
R3943:Tab1 UTSW 15 80153740 missense probably damaging 1.00
R3944:Tab1 UTSW 15 80153740 missense probably damaging 1.00
R4845:Tab1 UTSW 15 80152763 missense probably damaging 1.00
R5345:Tab1 UTSW 15 80149813 missense possibly damaging 0.48
R5696:Tab1 UTSW 15 80148729 nonsense probably null
R6223:Tab1 UTSW 15 80148263 missense probably damaging 1.00
R6242:Tab1 UTSW 15 80155770 nonsense probably null
R7239:Tab1 UTSW 15 80133171 missense probably benign 0.15
R7422:Tab1 UTSW 15 80160244 missense probably benign 0.00
R7810:Tab1 UTSW 15 80158798 missense possibly damaging 0.86
R8007:Tab1 UTSW 15 80158768 missense possibly damaging 0.94
R8037:Tab1 UTSW 15 80160270 missense probably benign 0.08
R8038:Tab1 UTSW 15 80160270 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGCCTGAAGCCTTCTCTGC -3'
(R):5'- ACCGTGAAGTGTACCCAGAAC -3'

Sequencing Primer
(F):5'- GCATGCCCCTGGTTTCAG -3'
(R):5'- ACCCAGAACTGATCTTTGGTAGG -3'
Posted On2018-06-06