Incidental Mutation 'R6561:Ier3ip1'
ID523150
Institutional Source Beutler Lab
Gene Symbol Ier3ip1
Ensembl Gene ENSMUSG00000090000
Gene Nameimmediate early response 3 interacting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R6561 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location76930017-76941605 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76939648 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 58 (S58T)
Ref Sequence ENSEMBL: ENSMUSP00000118504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026485] [ENSMUST00000026487] [ENSMUST00000097521] [ENSMUST00000097522] [ENSMUST00000142456] [ENSMUST00000143910] [ENSMUST00000145634] [ENSMUST00000147332] [ENSMUST00000148955] [ENSMUST00000150990] [ENSMUST00000156454]
Predicted Effect probably benign
Transcript: ENSMUST00000026485
SMART Domains Protein: ENSMUSP00000026485
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.1e-21 PFAM
Pfam:HAD_2 167 223 1e-7 PFAM
Pfam:Hydrolase_like 176 251 3.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000026487
AA Change: S58T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026487
Gene: ENSMUSG00000090000
AA Change: S58T

DomainStartEndE-ValueType
Pfam:Yos1 5 82 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097521
SMART Domains Protein: ENSMUSP00000095128
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 123 4.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097522
SMART Domains Protein: ENSMUSP00000095129
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136800
Predicted Effect probably damaging
Transcript: ENSMUST00000142456
AA Change: S58T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118504
Gene: ENSMUSG00000025421
AA Change: S58T

DomainStartEndE-ValueType
Pfam:Yos1 5 66 4.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143910
SMART Domains Protein: ENSMUSP00000118678
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 116 2.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145634
SMART Domains Protein: ENSMUSP00000123320
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147332
SMART Domains Protein: ENSMUSP00000116152
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 123 4.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148955
SMART Domains Protein: ENSMUSP00000116243
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150990
SMART Domains Protein: ENSMUSP00000114212
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 193 1.4e-21 PFAM
Pfam:HAD_2 161 223 1.1e-7 PFAM
Pfam:Hydrolase_like 176 251 1.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152369
Predicted Effect probably benign
Transcript: ENSMUST00000156454
SMART Domains Protein: ENSMUSP00000123035
Gene: ENSMUSG00000025421

DomainStartEndE-ValueType
Pfam:Hydrolase_6 10 60 1.6e-13 PFAM
Meta Mutation Damage Score 0.6358 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small protein that is localized to the endoplasmic reticulum (ER) and may play a role in the ER stress response by mediating cell differentiation and apoptosis. Transcription of this gene is regulated by tumor necrosis factor alpha and specificity protein 1 (Sp1). Mutations in this gene may play a role in microcephaly, epilepsy, and diabetes syndrome (MEDS), and a pseudogene of this gene is located on the long arm of chromosome 12. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,927,825 I468F probably benign Het
Ahsa2 T A 11: 23,491,036 I202F possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Anapc1 A G 2: 128,663,999 V639A probably damaging Het
Cdh12 A G 15: 21,492,594 Y233C probably damaging Het
Dchs2 G T 3: 83,129,169 V408F probably benign Het
Dnmt3c T A 2: 153,720,030 L551Q probably damaging Het
Dock2 A G 11: 34,687,538 F746S probably damaging Het
Fastkd3 C T 13: 68,584,030 R157C possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Itpr2 A G 6: 146,234,006 V1809A probably damaging Het
Kif22 T A 7: 127,031,053 N437I probably benign Het
Klri1 A G 6: 129,717,001 V41A probably benign Het
Lrrc14 T A 15: 76,713,446 D125E possibly damaging Het
Nek10 A T 14: 14,828,448 N90I possibly damaging Het
Nostrin G A 2: 69,180,857 A331T probably benign Het
Olfr1463 A G 19: 13,235,030 Y260C probably damaging Het
Olfr730 T C 14: 50,186,318 K300E probably damaging Het
Olfr870 T C 9: 20,170,777 T265A probably benign Het
Plxna1 A G 6: 89,356,978 V223A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Smg1 A T 7: 118,166,077 probably benign Het
Sorbs1 A G 19: 40,326,052 I772T probably benign Het
Sptbn2 A G 19: 4,747,926 N1927S probably benign Het
Tab1 T C 15: 80,148,830 V105A probably benign Het
Trbv15 A T 6: 41,141,480 T57S probably benign Het
Ttc37 T A 13: 76,150,519 S1115T probably damaging Het
Vmn1r78 A T 7: 12,152,899 I146F probably damaging Het
Vmn2r39 T A 7: 9,015,093 Y748F probably damaging Het
Zfp493 T A 13: 67,786,219 V65D possibly damaging Het
Other mutations in Ier3ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4469:Ier3ip1 UTSW 18 76940598 unclassified probably benign
R4888:Ier3ip1 UTSW 18 76939531 unclassified probably benign
R6953:Ier3ip1 UTSW 18 76939613 missense probably damaging 0.99
R7042:Ier3ip1 UTSW 18 76930132 missense possibly damaging 0.73
R7227:Ier3ip1 UTSW 18 76939634 missense probably benign 0.00
R8108:Ier3ip1 UTSW 18 76940525 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TCTTCACAGGGCTCAAACTAG -3'
(R):5'- GAGTGTACTAGTAACACTGAACTTCC -3'

Sequencing Primer
(F):5'- CAGGGCTCAAACTAGTTTTTAAAAG -3'
(R):5'- CTTCCTAGAAGTCAGATGCAATGG -3'
Posted On2018-06-06