Incidental Mutation 'PIT4131001:Cfap65'
ID 523155
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
Accession Numbers
Essential gene? Possibly essential (E-score: 0.720) question?
Stock # PIT4131001 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 74967501 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 192 (N192K)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: N192K

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: N192K

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139950
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (126/137)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,561,599 (GRCm39) probably benign Het
Alpk2 G A 18: 65,439,450 (GRCm39) H648Y possibly damaging Het
Ambp A G 4: 63,062,502 (GRCm39) Y246H probably damaging Het
Amz1 T C 5: 140,735,088 (GRCm39) probably null Het
Anks6 G A 4: 47,027,109 (GRCm39) T703I probably damaging Het
Armc2 A G 10: 41,823,883 (GRCm39) probably benign Het
Atp7b T A 8: 22,484,672 (GRCm39) I1347F probably damaging Het
Atp8a1 C T 5: 67,779,945 (GRCm39) W1149* probably null Het
Auh A G 13: 52,995,046 (GRCm39) I173T probably damaging Het
Axin2 T C 11: 108,814,829 (GRCm39) L239P possibly damaging Het
Bbs1 A T 19: 4,949,287 (GRCm39) F257L possibly damaging Het
Cacna2d2 C T 9: 107,401,867 (GRCm39) P774L probably damaging Het
Card6 A G 15: 5,137,788 (GRCm39) L22P probably damaging Het
Ccdc171 C T 4: 83,579,946 (GRCm39) Het
Ccn2 T C 10: 24,471,988 (GRCm39) V70A probably damaging Het
Cdc14a T A 3: 116,122,310 (GRCm39) N219I possibly damaging Het
Col14a1 T C 15: 55,312,272 (GRCm39) probably benign Het
Col5a1 A G 2: 27,914,665 (GRCm39) T94A probably benign Het
Col6a5 T C 9: 105,759,113 (GRCm39) N2031S probably damaging Het
Col7a1 T C 9: 108,794,989 (GRCm39) probably benign Het
Cyld T C 8: 89,473,543 (GRCm39) S739P probably damaging Het
Dbr1 A G 9: 99,466,072 (GRCm39) probably null Het
Dip2b T C 15: 100,100,233 (GRCm39) L1267P probably damaging Het
Dolk A G 2: 30,175,586 (GRCm39) M153T probably benign Het
Duxf1 C T 10: 58,060,704 (GRCm39) E17K possibly damaging Het
Duxf1 G A 10: 58,060,136 (GRCm39) probably benign Het
Duxf1 A G 10: 58,059,276 (GRCm39) C493R probably benign Het
Duxf3 A C 10: 58,067,498 (GRCm39) S27A probably benign Het
Eef1d C T 15: 75,775,581 (GRCm39) R26H probably benign Homo
Efcab5 C T 11: 77,028,517 (GRCm39) Het
Epc1 T C 18: 6,449,246 (GRCm39) D467G probably damaging Het
Fancm T G 12: 65,152,196 (GRCm39) M884R probably benign Het
Fbxo24 G T 5: 137,620,164 (GRCm39) H15N probably damaging Het
Frem1 A G 4: 82,924,045 (GRCm39) F305L probably damaging Het
Fstl5 A G 3: 76,567,006 (GRCm39) D550G probably damaging Het
Gcnt3 T G 9: 69,941,326 (GRCm39) K414T possibly damaging Het
Gm10718 A T 9: 3,024,417 (GRCm39) T134S probably benign Het
Gm10722 A G,C 9: 3,001,414 (GRCm39) probably benign Het
Gm10800 T C 2: 98,497,163 (GRCm39) R152G probably benign Homo
Gm10800 C A 2: 98,497,250 (GRCm39) V123F probably benign Homo
Gm10800 A C 2: 98,496,893 (GRCm39) F220C probably benign Het
Gm10801 A G 2: 98,492,648 (GRCm39) R23G probably benign Homo
Gm11168 C T 9: 3,004,605 (GRCm39) P49S probably benign Het
Gm21738 G A 14: 19,417,330 (GRCm38) S66L probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,194,000 (GRCm39) probably benign Het
Hmgcr A G 13: 96,795,562 (GRCm39) Y336H probably damaging Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Homo
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Homo
Igf2bp3 A C 6: 49,094,084 (GRCm39) probably null Het
Kcnb2 A T 1: 15,383,200 (GRCm39) K175N possibly damaging Het
Kdr T C 5: 76,102,631 (GRCm39) probably benign Het
Kif5c A G 2: 49,584,044 (GRCm39) K160E probably damaging Het
Kif7 A T 7: 79,360,817 (GRCm39) V186E probably damaging Het
Krt16 T A 11: 100,139,575 (GRCm39) T48S unknown Het
Liph T C 16: 21,814,119 (GRCm39) M1V probably null Het
Mctp2 A G 7: 71,740,005 (GRCm39) F795S probably damaging Het
Muc4 T A 16: 32,755,699 (GRCm38) probably benign Homo
Muc4 C G 16: 32,755,676 (GRCm38) probably benign Homo
Muc4 T A 16: 32,755,684 (GRCm38) probably benign Homo
Myo15a G T 11: 60,373,953 (GRCm39) A1267S probably damaging Het
Myo15a T C 11: 60,386,280 (GRCm39) Y1802H probably damaging Het
Myo7b G A 18: 32,094,259 (GRCm39) T1963I probably benign Het
Nadk2 TG T 15: 9,100,232 (GRCm39) probably null Homo
Naip5 T C 13: 100,356,268 (GRCm39) N1116D probably benign Het
Naip5 T C 13: 100,356,247 (GRCm39) R1123G probably benign Het
Nap1l1 A G 10: 111,322,583 (GRCm39) D61G probably null Het
Napsa A T 7: 44,230,875 (GRCm39) T81S probably damaging Het
Ngp T C 9: 110,251,337 (GRCm39) probably benign Het
Nktr T A 9: 121,570,687 (GRCm39) V143E probably damaging Het
Obscn A G 11: 58,957,890 (GRCm39) probably null Het
Or10ag53 G A 2: 87,082,973 (GRCm39) A231T probably benign Het
Or11i1 T C 3: 106,729,282 (GRCm39) I198V probably benign Het
Or4f56 G A 2: 111,703,649 (GRCm39) L184F probably benign Het
Or52ab2 C T 7: 102,970,076 (GRCm39) R153* probably null Het
Or52d3 G A 7: 104,229,237 (GRCm39) R128Q probably damaging Het
Or6p1 A G 1: 174,258,390 (GRCm39) Y132C probably damaging Het
Paip2b A G 6: 83,785,823 (GRCm39) Y136H probably damaging Het
Pde2a G T 7: 101,160,361 (GRCm39) R845L probably damaging Het
Pgap2 A G 7: 101,886,405 (GRCm39) Y197C possibly damaging Het
Phf11b A G 14: 59,560,611 (GRCm39) probably benign Het
Pitpnm2 A T 5: 124,269,178 (GRCm39) D481E probably benign Het
Pxk A T 14: 8,152,130 (GRCm38) H482L probably benign Het
Rad50 A G 11: 53,585,726 (GRCm39) probably null Het
Rbmyf1 T A Y: 2,787,132 (GRCm39) N228Y probably benign Het
Rbmyf5 T C Y: 3,297,411 (GRCm39) H235R probably benign Het
Rbmyf6 C T Y: 3,328,944 (GRCm39) A241T possibly damaging Het
Rnf220 A G 4: 117,134,566 (GRCm39) probably null Het
Saxo5 T A 8: 3,526,062 (GRCm39) S72T possibly damaging Het
Selenbp1 C T 3: 94,844,607 (GRCm39) T88M probably damaging Het
Sft2d1 T C 17: 8,609,863 (GRCm39) I104T possibly damaging Het
Sik1 A G 17: 32,070,305 (GRCm39) S135P probably damaging Het
Slc16a3 T C 11: 120,846,172 (GRCm39) F34L probably damaging Het
Slc6a20b T C 9: 123,612,126 (GRCm38) N85S probably benign Homo
Snrnp27 T C 6: 86,659,893 (GRCm39) R34G unknown Het
Sos2 T C 12: 69,664,851 (GRCm39) H393R probably benign Het
Sp110 C T 1: 85,513,971 (GRCm39) R262Q probably benign Het
Sp110 T C 1: 85,513,975 (GRCm39) R261G probably benign Het
Sp140 T A 1: 85,528,893 (GRCm39) Y5N probably benign Het
Sp140 A G 1: 85,570,942 (GRCm39) S461G probably benign Het
Sp140 G C 1: 85,538,603 (GRCm39) K113N probably benign Het
Sp140l1 G A 1: 85,077,341 (GRCm39) A75V probably benign Het
Sp140l2 A C 1: 85,223,395 (GRCm39) probably benign Het
Speer4a2 A T 5: 26,291,485 (GRCm39) F107Y probably benign Het
Speer4a2 C G 5: 26,294,093 (GRCm39) W28C probably damaging Het
Ssrp1 G A 2: 84,868,760 (GRCm39) V40M probably damaging Het
Tada2a T C 11: 83,970,563 (GRCm39) E202G probably damaging Het
Tcf20 C A 15: 82,735,785 (GRCm39) A1889S probably damaging Het
Tdrd12 A T 7: 35,180,528 (GRCm39) Y828* probably null Het
Tlr2 T A 3: 83,745,756 (GRCm39) D109V probably benign Het
Tomm40 G A 7: 19,437,016 (GRCm39) T17M probably damaging Het
Tsga10ip T C 19: 5,440,161 (GRCm39) T135A possibly damaging Het
Tspan8 G A 10: 115,653,515 (GRCm39) V4M probably damaging Het
Ttc28 A T 5: 111,040,719 (GRCm39) T36S probably benign Het
Ugt1a6b G A 1: 88,146,112 (GRCm39) R519Q probably damaging Het
Ugt1a6b TTCA T 1: 88,143,880 (GRCm39) probably benign Het
Ugt1a6b G A 1: 88,143,976 (GRCm39) A199T probably damaging Het
Unc45a A G 7: 79,976,109 (GRCm39) M790T possibly damaging Het
Vav3 T C 3: 109,571,751 (GRCm39) probably null Het
Vcpkmt G A 12: 69,629,552 (GRCm39) S70L probably benign Het
Vmn1r3 C T 4: 3,184,691 (GRCm39) M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 (GRCm39) V178I probably benign Het
Vmn2r66 T C 7: 84,644,301 (GRCm39) Q703R probably damaging Het
Vmn2r98 G T 17: 19,301,223 (GRCm39) V742F probably benign Het
Wfdc8 A G 2: 164,439,696 (GRCm39) S229P possibly damaging Het
Xpo4 A T 14: 57,822,068 (GRCm39) C1083S probably null Het
Zbtb38 T C 9: 96,568,369 (GRCm39) D905G probably damaging Het
Zbtb8b A G 4: 129,321,308 (GRCm39) *518Q probably null Het
Zfp600 TC T 4: 146,131,802 (GRCm39) probably null Het
Zfp992 C T 4: 146,550,569 (GRCm39) P97S probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCCAGGTGAAGAAGGTG -3'
(R):5'- AAGTGGAATGTCCTGACTCTTACC -3'

Sequencing Primer
(F):5'- TGAAGAAGGTGGGCAGGTCC -3'
(R):5'- GGAATGTCCTGACTCTTACCTGAAC -3'
Posted On 2018-06-12