Incidental Mutation 'PIT4131001:Pitpnm2'
ID523199
Institutional Source Beutler Lab
Gene Symbol Pitpnm2
Ensembl Gene ENSMUSG00000029406
Gene Namephosphatidylinositol transfer protein, membrane-associated 2
SynonymsNIR3, RDGBA2, Rdgb2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4131001 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location124118690-124249760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124131115 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 481 (D481E)
Ref Sequence ENSEMBL: ENSMUSP00000124740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086123] [ENSMUST00000159677] [ENSMUST00000161273] [ENSMUST00000161938] [ENSMUST00000162812]
Predicted Effect probably benign
Transcript: ENSMUST00000086123
AA Change: D481E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406
AA Change: D481E

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159010
Predicted Effect probably benign
Transcript: ENSMUST00000159677
SMART Domains Protein: ENSMUSP00000143269
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-130 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161273
AA Change: D481E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406
AA Change: D481E

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-129 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 945 7.5e-100 SMART
LNS2 1090 1221 3.1e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161530
Predicted Effect probably benign
Transcript: ENSMUST00000161938
AA Change: D481E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406
AA Change: D481E

DomainStartEndE-ValueType
Pfam:IP_trans 1 251 7.5e-116 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 949 8.37e-104 SMART
LNS2 1094 1225 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162812
AA Change: D481E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406
AA Change: D481E

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (126/137)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no defects pertaining to photoreceptor function or survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,719,806 probably benign Het
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Alpk2 G A 18: 65,306,379 H648Y possibly damaging Het
Ambp A G 4: 63,144,265 Y246H probably damaging Het
Amz1 T C 5: 140,749,333 probably null Het
Anks6 G A 4: 47,027,109 T703I probably damaging Het
Armc2 A G 10: 41,947,887 probably benign Het
Atp7b T A 8: 21,994,656 I1347F probably damaging Het
Atp8a1 C T 5: 67,622,602 W1149* probably null Het
Auh A G 13: 52,841,010 I173T probably damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G A 10: 58,224,314 probably benign Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
Axin2 T C 11: 108,924,003 L239P possibly damaging Het
Bbs1 A T 19: 4,899,259 F257L possibly damaging Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
Cacna2d2 C T 9: 107,524,668 P774L probably damaging Het
Card6 A G 15: 5,108,306 L22P probably damaging Het
Ccdc171 C T 4: 83,661,709 Het
Cdc14a T A 3: 116,328,661 N219I possibly damaging Het
Cfap65 G T 1: 74,928,342 N192K probably benign Het
Col14a1 T C 15: 55,448,876 probably benign Het
Col5a1 A G 2: 28,024,653 T94A probably benign Het
Col6a5 T C 9: 105,881,914 N2031S probably damaging Het
Col7a1 T C 9: 108,965,921 probably benign Het
Ctgf T C 10: 24,596,090 V70A probably damaging Het
Cyld T C 8: 88,746,915 S739P probably damaging Het
Dbr1 A G 9: 99,584,019 probably null Het
Dip2b T C 15: 100,202,352 L1267P probably damaging Het
Dolk A G 2: 30,285,574 M153T probably benign Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Eef1d C T 15: 75,903,732 R26H probably benign Homo
Efcab5 C T 11: 77,137,691 Het
Epc1 T C 18: 6,449,246 D467G probably damaging Het
Fancm T G 12: 65,105,422 M884R probably benign Het
Fbxo24 G T 5: 137,621,902 H15N probably damaging Het
Frem1 A G 4: 83,005,808 F305L probably damaging Het
Fstl5 A G 3: 76,659,699 D550G probably damaging Het
Gcnt3 T G 9: 70,034,044 K414T possibly damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 A G,C 9: 3,001,414 probably benign Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Homo
Gm10800 C A 2: 98,666,905 V123F probably benign Homo
Gm10801 A G 2: 98,662,303 R23G probably benign Homo
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21677 T C Y: 3,297,411 H235R probably benign Het
Gm21693 C T Y: 3,328,944 A241T possibly damaging Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hmgcr A G 13: 96,659,054 Y336H probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Homo
Hoxa13 G C 6: 52,260,648 probably benign Homo
Igf2bp3 A C 6: 49,117,150 probably null Het
Kcnb2 A T 1: 15,312,976 K175N possibly damaging Het
Kdr T C 5: 75,941,971 probably benign Het
Kif5c A G 2: 49,694,032 K160E probably damaging Het
Kif7 A T 7: 79,711,069 V186E probably damaging Het
Krt16 T A 11: 100,248,749 T48S unknown Het
Liph T C 16: 21,995,369 M1V probably null Het
Mctp2 A G 7: 72,090,257 F795S probably damaging Het
Muc4 C G 16: 32,755,676 probably benign Homo
Muc4 T A 16: 32,755,684 probably benign Homo
Muc4 T A 16: 32,755,699 probably benign Homo
Myo15 G T 11: 60,483,127 A1267S probably damaging Het
Myo15 T C 11: 60,495,454 Y1802H probably damaging Het
Myo7b G A 18: 31,961,206 T1963I probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Homo
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Naip5 T C 13: 100,219,760 N1116D probably benign Het
Nap1l1 A G 10: 111,486,722 D61G probably null Het
Napsa A T 7: 44,581,451 T81S probably damaging Het
Ngp T C 9: 110,422,269 probably benign Het
Nktr T A 9: 121,741,621 V143E probably damaging Het
Obscn A G 11: 59,067,064 probably null Het
Olfr1115 G A 2: 87,252,629 A231T probably benign Het
Olfr1305 G A 2: 111,873,304 L184F probably benign Het
Olfr266 T C 3: 106,821,966 I198V probably benign Het
Olfr414 A G 1: 174,430,824 Y132C probably damaging Het
Olfr597 C T 7: 103,320,869 R153* probably null Het
Olfr653 G A 7: 104,580,030 R128Q probably damaging Het
Paip2b A G 6: 83,808,841 Y136H probably damaging Het
Pde2a G T 7: 101,511,154 R845L probably damaging Het
Pgap2 A G 7: 102,237,198 Y197C possibly damaging Het
Phf11b A G 14: 59,323,162 probably benign Het
Pxk A T 14: 8,152,130 H482L probably benign Het
Rad50 A G 11: 53,694,899 probably null Het
Rnf220 A G 4: 117,277,369 probably null Het
Selenbp1 C T 3: 94,937,296 T88M probably damaging Het
Sft2d1 T C 17: 8,391,031 I104T possibly damaging Het
Sik1 A G 17: 31,851,331 S135P probably damaging Het
Slc16a3 T C 11: 120,955,346 F34L probably damaging Het
Slc6a20b T C 9: 123,612,126 N85S probably benign Homo
Snrnp27 T C 6: 86,682,911 R34G unknown Het
Sos2 T C 12: 69,618,077 H393R probably benign Het
Sp110 C T 1: 85,586,250 R262Q probably benign Het
Sp110 T C 1: 85,586,254 R261G probably benign Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Ssrp1 G A 2: 85,038,416 V40M probably damaging Het
Tada2a T C 11: 84,079,737 E202G probably damaging Het
Tcf20 C A 15: 82,851,584 A1889S probably damaging Het
Tdrd12 A T 7: 35,481,103 Y828* probably null Het
Tex45 T A 8: 3,476,062 S72T possibly damaging Het
Tlr2 T A 3: 83,838,449 D109V probably benign Het
Tomm40 G A 7: 19,703,091 T17M probably damaging Het
Tsga10ip T C 19: 5,390,133 T135A possibly damaging Het
Tspan8 G A 10: 115,817,610 V4M probably damaging Het
Ttc28 A T 5: 110,892,853 T36S probably benign Het
Ugt1a6b TTCA T 1: 88,216,158 probably benign Het
Ugt1a6b G A 1: 88,216,254 A199T probably damaging Het
Ugt1a6b G A 1: 88,218,390 R519Q probably damaging Het
Unc45a A G 7: 80,326,361 M790T possibly damaging Het
Vav3 T C 3: 109,664,435 probably null Het
Vcpkmt G A 12: 69,582,778 S70L probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn2r66 T C 7: 84,995,093 Q703R probably damaging Het
Vmn2r98 G T 17: 19,080,961 V742F probably benign Het
Wfdc8 A G 2: 164,597,776 S229P possibly damaging Het
Xpo4 A T 14: 57,584,611 C1083S probably null Het
Zbtb38 T C 9: 96,686,316 D905G probably damaging Het
Zbtb8b A G 4: 129,427,515 *518Q probably null Het
Zfp600 TC T 4: 146,195,232 probably null Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Pitpnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pitpnm2 APN 5 124121663 unclassified probably benign
IGL01660:Pitpnm2 APN 5 124123194 missense probably damaging 1.00
IGL02328:Pitpnm2 APN 5 124121414 missense probably damaging 0.99
IGL02340:Pitpnm2 APN 5 124130613 missense probably damaging 1.00
IGL02399:Pitpnm2 APN 5 124140758 splice site probably benign
IGL02719:Pitpnm2 APN 5 124140602 missense probably damaging 1.00
IGL03053:Pitpnm2 APN 5 124143601 missense probably damaging 1.00
IGL03083:Pitpnm2 APN 5 124133382 missense possibly damaging 0.92
R0058:Pitpnm2 UTSW 5 124124030 missense probably damaging 1.00
R0437:Pitpnm2 UTSW 5 124131089 splice site probably benign
R0530:Pitpnm2 UTSW 5 124131201 missense probably damaging 1.00
R0568:Pitpnm2 UTSW 5 124140517 splice site probably benign
R0926:Pitpnm2 UTSW 5 124131209 missense probably benign 0.10
R1625:Pitpnm2 UTSW 5 124133433 missense probably benign 0.05
R2008:Pitpnm2 UTSW 5 124152621 start codon destroyed probably damaging 0.99
R2120:Pitpnm2 UTSW 5 124127269 missense probably damaging 1.00
R2354:Pitpnm2 UTSW 5 124122919 missense probably damaging 0.99
R2448:Pitpnm2 UTSW 5 124123994 missense probably damaging 1.00
R2509:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2510:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2511:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2520:Pitpnm2 UTSW 5 124129401 missense probably damaging 0.96
R2860:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R2861:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R4407:Pitpnm2 UTSW 5 124152615 missense possibly damaging 0.57
R4417:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R4426:Pitpnm2 UTSW 5 124142123 missense probably benign 0.32
R4458:Pitpnm2 UTSW 5 124121376 missense probably benign 0.00
R4610:Pitpnm2 UTSW 5 124125371 missense probably damaging 0.99
R4786:Pitpnm2 UTSW 5 124121743 nonsense probably null
R4903:Pitpnm2 UTSW 5 124152605 missense probably damaging 1.00
R5151:Pitpnm2 UTSW 5 124136386 missense probably damaging 1.00
R5315:Pitpnm2 UTSW 5 124121933 missense probably benign 0.18
R5592:Pitpnm2 UTSW 5 124142149 missense probably damaging 1.00
R5792:Pitpnm2 UTSW 5 124130321 nonsense probably null
R6846:Pitpnm2 UTSW 5 124131171 missense probably benign 0.00
R6983:Pitpnm2 UTSW 5 124133406 missense probably damaging 1.00
R7096:Pitpnm2 UTSW 5 124129261 missense possibly damaging 0.69
R7188:Pitpnm2 UTSW 5 124121303 missense probably benign 0.31
R7203:Pitpnm2 UTSW 5 124121459 missense probably damaging 0.96
R7237:Pitpnm2 UTSW 5 124125297 critical splice donor site probably null
R7257:Pitpnm2 UTSW 5 124125356 missense possibly damaging 0.88
R7622:Pitpnm2 UTSW 5 124122027 missense probably benign 0.39
R7677:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R7736:Pitpnm2 UTSW 5 124123030 missense possibly damaging 0.47
R7745:Pitpnm2 UTSW 5 124128705 missense probably benign 0.19
R8041:Pitpnm2 UTSW 5 124121456 missense not run
Predicted Primers PCR Primer
(F):5'- TGACCTTATCTTGTCTGCATGG -3'
(R):5'- ACCCTCCAAGATTCACGTGC -3'

Sequencing Primer
(F):5'- TCTGCATGGGCTCTGCTGC -3'
(R):5'- AAGATTCACGTGCTGCTGC -3'
Posted On2018-06-12