Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4131001:Naip5'

523253

Institutional Source

Beutler Lab

Gene Symbol

Naip5

Ensembl Gene

ENSMUSG00000071203

Gene Name

NLR family, apoptosis inhibitory protein 5

Synonyms

Birc1e, Lgn1, Naip-rs3

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

PIT4131001 (G1)

Quality Score

175.009

Status

Not validated

Chromosome

Chromosomal Location

100211739-100246323 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100219760 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 1116 (N1116D)

Ref Sequence

ENSEMBL: ENSMUSP00000058611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049789]

AlphaFold

Q9R016

Predicted Effect

probably benign
Transcript: ENSMUST00000049789
AA Change: N1116D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: N1116D

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
BIR	58	129	1.08e-19	SMART
BIR	157	229	1.06e-36	SMART
BIR	276	347	2.14e-32	SMART
Pfam:NACHT	464	618	1.7e-36	PFAM
low complexity region	851	862	N/A	INTRINSIC

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

92% (126/137)

MGI Phenotype

PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 128 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010B08Rik	C	T	2: 173,719,806		probably benign	Het
A530032D15Rik	G	A	1: 85,099,620	A75V	probably benign	Het
Alpk2	G	A	18: 65,306,379	H648Y	possibly damaging	Het
Ambp	A	G	4: 63,144,265	Y246H	probably damaging	Het
Amz1	T	C	5: 140,749,333		probably null	Het
Anks6	G	A	4: 47,027,109	T703I	probably damaging	Het
Armc2	A	G	10: 41,947,887		probably benign	Het
Atp7b	T	A	8: 21,994,656	I1347F	probably damaging	Het
Atp8a1	C	T	5: 67,622,602	W1149*	probably null	Het
Auh	A	G	13: 52,841,010	I173T	probably damaging	Het
AW822073	A	G	10: 58,223,454	C493R	probably benign	Het
AW822073	G	A	10: 58,224,314		probably benign	Het
AW822073	C	T	10: 58,224,882	E17K	possibly damaging	Het
Axin2	T	C	11: 108,924,003	L239P	possibly damaging	Het
Bbs1	A	T	19: 4,899,259	F257L	possibly damaging	Het
C130026I21Rik	A	C	1: 85,245,674		probably benign	Het
Cacna2d2	C	T	9: 107,524,668	P774L	probably damaging	Het
Card6	A	G	15: 5,108,306	L22P	probably damaging	Het
Ccdc171	C	T	4: 83,661,709			Het
Cdc14a	T	A	3: 116,328,661	N219I	possibly damaging	Het
Cfap65	G	T	1: 74,928,342	N192K	probably benign	Het
Col14a1	T	C	15: 55,448,876		probably benign	Het
Col5a1	A	G	2: 28,024,653	T94A	probably benign	Het
Col6a5	T	C	9: 105,881,914	N2031S	probably damaging	Het
Col7a1	T	C	9: 108,965,921		probably benign	Het
Ctgf	T	C	10: 24,596,090	V70A	probably damaging	Het
Cyld	T	C	8: 88,746,915	S739P	probably damaging	Het
Dbr1	A	G	9: 99,584,019		probably null	Het
Dip2b	T	C	15: 100,202,352	L1267P	probably damaging	Het
Dolk	A	G	2: 30,285,574	M153T	probably benign	Het
Duxf3	A	C	10: 58,231,676	S27A	probably benign	Het
Eef1d	C	T	15: 75,903,732	R26H	probably benign	Homo
Efcab5	C	T	11: 77,137,691			Het
Epc1	T	C	18: 6,449,246	D467G	probably damaging	Het
Fancm	T	G	12: 65,105,422	M884R	probably benign	Het
Fbxo24	G	T	5: 137,621,902	H15N	probably damaging	Het
Frem1	A	G	4: 83,005,808	F305L	probably damaging	Het
Fstl5	A	G	3: 76,659,699	D550G	probably damaging	Het
Gcnt3	T	G	9: 70,034,044	K414T	possibly damaging	Het
Gm10471	A	T	5: 26,086,487	F107Y	probably benign	Het
Gm10471	C	G	5: 26,089,095	W28C	probably damaging	Het
Gm10718	A	T	9: 3,024,417	T134S	probably benign	Het
Gm10722	A	G,C	9: 3,001,414		probably benign	Het
Gm10800	A	C	2: 98,666,548	F220C	probably benign	Het
Gm10800	T	C	2: 98,666,818	R152G	probably benign	Homo
Gm10800	C	A	2: 98,666,905	V123F	probably benign	Homo
Gm10801	A	G	2: 98,662,303	R23G	probably benign	Homo
Gm11168	C	T	9: 3,004,605	P49S	probably benign	Het
Gm21677	T	C	Y: 3,297,411	H235R	probably benign	Het
Gm21693	C	T	Y: 3,328,944	A241T	possibly damaging	Het
Gm21738	G	A	14: 19,417,330	S66L	probably benign	Het
Gm4064	T	A	Y: 2,787,132	N228Y	probably benign	Het
Hjurp	TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG	T	1: 88,266,278		probably benign	Het
Hmgcr	A	G	13: 96,659,054	Y336H	probably damaging	Het
Hoxa13	C	G	6: 52,260,647		probably benign	Homo
Hoxa13	G	C	6: 52,260,648		probably benign	Homo
Igf2bp3	A	C	6: 49,117,150		probably null	Het
Kcnb2	A	T	1: 15,312,976	K175N	possibly damaging	Het
Kdr	T	C	5: 75,941,971		probably benign	Het
Kif5c	A	G	2: 49,694,032	K160E	probably damaging	Het
Kif7	A	T	7: 79,711,069	V186E	probably damaging	Het
Krt16	T	A	11: 100,248,749	T48S	unknown	Het
Liph	T	C	16: 21,995,369	M1V	probably null	Het
Mctp2	A	G	7: 72,090,257	F795S	probably damaging	Het
Muc4	C	G	16: 32,755,676		probably benign	Homo
Muc4	T	A	16: 32,755,684		probably benign	Homo
Muc4	T	A	16: 32,755,699		probably benign	Homo
Myo15	G	T	11: 60,483,127	A1267S	probably damaging	Het
Myo15	T	C	11: 60,495,454	Y1802H	probably damaging	Het
Myo7b	G	A	18: 31,961,206	T1963I	probably benign	Het
Nadk2	TG	T	15: 9,100,143		probably null	Homo
Nap1l1	A	G	10: 111,486,722	D61G	probably null	Het
Napsa	A	T	7: 44,581,451	T81S	probably damaging	Het
Ngp	T	C	9: 110,422,269		probably benign	Het
Nktr	T	A	9: 121,741,621	V143E	probably damaging	Het
Obscn	A	G	11: 59,067,064		probably null	Het
Olfr1115	G	A	2: 87,252,629	A231T	probably benign	Het
Olfr1305	G	A	2: 111,873,304	L184F	probably benign	Het
Olfr266	T	C	3: 106,821,966	I198V	probably benign	Het
Olfr414	A	G	1: 174,430,824	Y132C	probably damaging	Het
Olfr597	C	T	7: 103,320,869	R153*	probably null	Het
Olfr653	G	A	7: 104,580,030	R128Q	probably damaging	Het
Paip2b	A	G	6: 83,808,841	Y136H	probably damaging	Het
Pde2a	G	T	7: 101,511,154	R845L	probably damaging	Het
Pgap2	A	G	7: 102,237,198	Y197C	possibly damaging	Het
Phf11b	A	G	14: 59,323,162		probably benign	Het
Pitpnm2	A	T	5: 124,131,115	D481E	probably benign	Het
Pxk	A	T	14: 8,152,130	H482L	probably benign	Het
Rad50	A	G	11: 53,694,899		probably null	Het
Rnf220	A	G	4: 117,277,369		probably null	Het
Selenbp1	C	T	3: 94,937,296	T88M	probably damaging	Het
Sft2d1	T	C	17: 8,391,031	I104T	possibly damaging	Het
Sik1	A	G	17: 31,851,331	S135P	probably damaging	Het
Slc16a3	T	C	11: 120,955,346	F34L	probably damaging	Het
Slc6a20b	T	C	9: 123,612,126	N85S	probably benign	Homo
Snrnp27	T	C	6: 86,682,911	R34G	unknown	Het
Sos2	T	C	12: 69,618,077	H393R	probably benign	Het
Sp110	C	T	1: 85,586,250	R262Q	probably benign	Het
Sp110	T	C	1: 85,586,254	R261G	probably benign	Het
Sp140	T	A	1: 85,601,172	Y5N	probably benign	Het
Sp140	G	C	1: 85,610,882	K113N	probably benign	Het
Sp140	A	G	1: 85,643,221	S461G	probably benign	Het
Ssrp1	G	A	2: 85,038,416	V40M	probably damaging	Het
Tada2a	T	C	11: 84,079,737	E202G	probably damaging	Het
Tcf20	C	A	15: 82,851,584	A1889S	probably damaging	Het
Tdrd12	A	T	7: 35,481,103	Y828*	probably null	Het
Tex45	T	A	8: 3,476,062	S72T	possibly damaging	Het
Tlr2	T	A	3: 83,838,449	D109V	probably benign	Het
Tomm40	G	A	7: 19,703,091	T17M	probably damaging	Het
Tsga10ip	T	C	19: 5,390,133	T135A	possibly damaging	Het
Tspan8	G	A	10: 115,817,610	V4M	probably damaging	Het
Ttc28	A	T	5: 110,892,853	T36S	probably benign	Het
Ugt1a6b	TTCA	T	1: 88,216,158		probably benign	Het
Ugt1a6b	G	A	1: 88,216,254	A199T	probably damaging	Het
Ugt1a6b	G	A	1: 88,218,390	R519Q	probably damaging	Het
Unc45a	A	G	7: 80,326,361	M790T	possibly damaging	Het
Vav3	T	C	3: 109,664,435		probably null	Het
Vcpkmt	G	A	12: 69,582,778	S70L	probably benign	Het
Vmn1r3	C	T	4: 3,184,691	M205I	probably damaging	Het
Vmn1r3	C	T	4: 3,184,774	V178I	probably benign	Het
Vmn2r66	T	C	7: 84,995,093	Q703R	probably damaging	Het
Vmn2r98	G	T	17: 19,080,961	V742F	probably benign	Het
Wfdc8	A	G	2: 164,597,776	S229P	possibly damaging	Het
Xpo4	A	T	14: 57,584,611	C1083S	probably null	Het
Zbtb38	T	C	9: 96,686,316	D905G	probably damaging	Het
Zbtb8b	A	G	4: 129,427,515	*518Q	probably null	Het
Zfp600	TC	T	4: 146,195,232		probably null	Het
Zfp992	C	T	4: 146,466,112	P97S	probably benign	Het

Other mutations in Naip5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Naip5	APN	13	100246175	nonsense	probably null
IGL00493:Naip5	APN	13	100230771	missense	probably damaging	0.96
IGL01294:Naip5	APN	13	100217080	missense	probably damaging	0.99
IGL01405:Naip5	APN	13	100221945	missense	probably benign	0.11
IGL01568:Naip5	APN	13	100217101	missense	probably benign	0.26
IGL01804:Naip5	APN	13	100221584	missense	probably damaging	1.00
IGL02012:Naip5	APN	13	100223339	missense	probably benign	0.01
IGL02183:Naip5	APN	13	100221642	missense	probably benign	0.41
IGL02449:Naip5	APN	13	100222175	missense	probably benign	0.34
IGL02815:Naip5	APN	13	100222731	missense	probably benign
IGL02992:Naip5	APN	13	100223028	missense	probably damaging	1.00
IGL03027:Naip5	APN	13	100223016	missense	probably benign	0.00
IGL03234:Naip5	APN	13	100212627	missense	probably damaging	1.00
inwood2	UTSW	13	100223014	nonsense	probably null
inwood3	UTSW	13	100221903	nonsense	probably null
Nuchal	UTSW	13	100214663	missense	possibly damaging	0.82
PIT4131001:Naip5	UTSW	13	100219739	missense	probably benign
R0001:Naip5	UTSW	13	100214650	critical splice donor site	probably null
R0001:Naip5	UTSW	13	100223114	missense	probably benign
R0462:Naip5	UTSW	13	100221732	missense	probably damaging	1.00
R0636:Naip5	UTSW	13	100219688	missense	probably benign
R0674:Naip5	UTSW	13	100223199	missense	probably benign	0.04
R0764:Naip5	UTSW	13	100217105	missense	probably benign	0.03
R0837:Naip5	UTSW	13	100230743	missense	probably benign
R1179:Naip5	UTSW	13	100219830	missense	probably benign
R1302:Naip5	UTSW	13	100221591	missense	possibly damaging	0.91
R1441:Naip5	UTSW	13	100219717	missense	possibly damaging	0.95
R1513:Naip5	UTSW	13	100222206	missense	probably benign
R1638:Naip5	UTSW	13	100212669	missense	probably damaging	1.00
R1651:Naip5	UTSW	13	100221911	missense	probably benign	0.41
R1707:Naip5	UTSW	13	100242855	missense	probably damaging	1.00
R1835:Naip5	UTSW	13	100223218	nonsense	probably null
R1836:Naip5	UTSW	13	100219687	missense	probably benign	0.18
R1972:Naip5	UTSW	13	100212770	missense	probably damaging	0.98
R2080:Naip5	UTSW	13	100221533	missense	probably damaging	1.00
R2333:Naip5	UTSW	13	100223171	missense	probably damaging	1.00
R2348:Naip5	UTSW	13	100219738	missense	probably benign	0.01
R3055:Naip5	UTSW	13	100221878	missense	probably benign	0.23
R3401:Naip5	UTSW	13	100221903	nonsense	probably null
R3723:Naip5	UTSW	13	100223014	nonsense	probably null
R3775:Naip5	UTSW	13	100223375	missense	probably benign	0.00
R3775:Naip5	UTSW	13	100223394	missense	probably benign	0.00
R4019:Naip5	UTSW	13	100223375	missense	probably benign	0.00
R4019:Naip5	UTSW	13	100223394	missense	probably benign	0.00
R4020:Naip5	UTSW	13	100223375	missense	probably benign	0.00
R4020:Naip5	UTSW	13	100223394	missense	probably benign	0.00
R4074:Naip5	UTSW	13	100246064	missense	probably damaging	1.00
R4082:Naip5	UTSW	13	100245830	missense	probably damaging	1.00
R4105:Naip5	UTSW	13	100219739	missense	probably benign
R4227:Naip5	UTSW	13	100212768	missense	probably damaging	0.99
R4639:Naip5	UTSW	13	100219830	missense	probably benign
R4640:Naip5	UTSW	13	100219830	missense	probably benign
R4641:Naip5	UTSW	13	100219830	missense	probably benign
R4644:Naip5	UTSW	13	100219830	missense	probably benign
R4645:Naip5	UTSW	13	100219830	missense	probably benign
R4700:Naip5	UTSW	13	100223414	missense	possibly damaging	0.62
R4727:Naip5	UTSW	13	100221870	missense	possibly damaging	0.81
R4729:Naip5	UTSW	13	100222131	missense	possibly damaging	0.75
R4816:Naip5	UTSW	13	100219681	missense	probably benign	0.32
R4816:Naip5	UTSW	13	100219687	missense	probably benign	0.01
R4816:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R4869:Naip5	UTSW	13	100245131	missense	probably damaging	1.00
R5162:Naip5	UTSW	13	100223406	missense	possibly damaging	0.78
R5244:Naip5	UTSW	13	100245662	missense	probably benign	0.08
R5411:Naip5	UTSW	13	100245746	missense	possibly damaging	0.54
R5632:Naip5	UTSW	13	100230662	splice site	probably null
R5760:Naip5	UTSW	13	100242838	missense	probably damaging	1.00
R5916:Naip5	UTSW	13	100222701	missense	probably benign	0.02
R6302:Naip5	UTSW	13	100223166	missense	possibly damaging	0.76
R6304:Naip5	UTSW	13	100223166	missense	possibly damaging	0.76
R6411:Naip5	UTSW	13	100223405	missense	probably benign	0.01
R6474:Naip5	UTSW	13	100214663	missense	possibly damaging	0.82
R6499:Naip5	UTSW	13	100221594	missense	probably benign
R6544:Naip5	UTSW	13	100223144	missense	possibly damaging	0.50
R6827:Naip5	UTSW	13	100245929	missense	possibly damaging	0.48
R6954:Naip5	UTSW	13	100223414	missense	probably damaging	0.99
R7052:Naip5	UTSW	13	100222347	missense	probably benign	0.01
R7138:Naip5	UTSW	13	100219830	missense	probably benign
R7141:Naip5	UTSW	13	100219830	missense	probably benign
R7375:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7375:Naip5	UTSW	13	100219697	missense	not run
R7401:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7401:Naip5	UTSW	13	100219697	missense	not run
R7447:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7447:Naip5	UTSW	13	100219697	missense	not run
R7466:Naip5	UTSW	13	100221986	nonsense	probably null
R7491:Naip5	UTSW	13	100217071	missense	probably benign	0.18
R7559:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7559:Naip5	UTSW	13	100219697	missense	not run
R7562:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7562:Naip5	UTSW	13	100219697	missense	not run
R7588:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7588:Naip5	UTSW	13	100219697	missense	not run
R7589:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7589:Naip5	UTSW	13	100219697	missense	not run
R7590:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7590:Naip5	UTSW	13	100219697	missense	not run
R7742:Naip5	UTSW	13	100219830	missense	probably benign
R7886:Naip5	UTSW	13	100246181	missense	probably benign	0.28
R7996:Naip5	UTSW	13	100221656	missense	probably damaging	1.00
R8026:Naip5	UTSW	13	100245898	missense	probably damaging	1.00
R8046:Naip5	UTSW	13	100222233	missense	probably benign
R8319:Naip5	UTSW	13	100221659	missense	probably benign	0.12
R8471:Naip5	UTSW	13	100221645	missense	probably damaging	0.99
R8480:Naip5	UTSW	13	100222235	missense	probably damaging	1.00
R8496:Naip5	UTSW	13	100212739	missense	probably benign	0.00
R8500:Naip5	UTSW	13	100222712	missense	probably damaging	0.98
R8712:Naip5	UTSW	13	100223096	missense	possibly damaging	0.61
R8780:Naip5	UTSW	13	100219830	missense	probably benign
R8781:Naip5	UTSW	13	100219830	missense	probably benign
R8788:Naip5	UTSW	13	100219830	missense	probably benign
R8817:Naip5	UTSW	13	100212699	missense	probably benign	0.01
R8833:Naip5	UTSW	13	100222934	missense	probably damaging	0.97
R8835:Naip5	UTSW	13	100219830	missense	probably benign
R8958:Naip5	UTSW	13	100217609	nonsense	probably null
R9031:Naip5	UTSW	13	100219830	missense	probably benign
R9032:Naip5	UTSW	13	100219830	missense	probably benign
R9074:Naip5	UTSW	13	100221756	missense	possibly damaging	0.92
R9098:Naip5	UTSW	13	100229619	missense	possibly damaging	0.67
R9204:Naip5	UTSW	13	100222500	missense	probably damaging	1.00
R9223:Naip5	UTSW	13	100227676	missense	probably benign	0.05
R9358:Naip5	UTSW	13	100219830	missense	probably benign
R9389:Naip5	UTSW	13	100219830	missense	probably benign
R9403:Naip5	UTSW	13	100219830	missense	probably benign
R9518:Naip5	UTSW	13	100221859	missense	probably benign
R9568:Naip5	UTSW	13	100219830	missense	probably benign
R9568:Naip5	UTSW	13	100223313	missense	probably benign	0.00
R9569:Naip5	UTSW	13	100219830	missense	probably benign
R9569:Naip5	UTSW	13	100223313	missense	probably benign	0.00
R9570:Naip5	UTSW	13	100223313	missense	probably benign	0.00
R9572:Naip5	UTSW	13	100223313	missense	probably benign	0.00
R9581:Naip5	UTSW	13	100214686	missense	probably benign	0.11
R9627:Naip5	UTSW	13	100219830	missense	probably benign
R9725:Naip5	UTSW	13	100222276	missense	possibly damaging	0.94
R9763:Naip5	UTSW	13	100230761	missense	probably damaging	0.99
R9764:Naip5	UTSW	13	100230761	missense	probably damaging	0.99
R9765:Naip5	UTSW	13	100230761	missense	probably damaging	0.99

Predicted Primers

Posted On

2018-06-12