Incidental Mutation 'PIT4131001:Gm21738'
ID 523255
Institutional Source Beutler Lab
Gene Symbol Gm21738
Ensembl Gene ENSMUSG00000095280
Gene Name predicted gene, 21738
Synonyms
Accession Numbers
Essential gene? Probably essential (E-score: 0.905) question?
Stock # PIT4131001 (G1)
Quality Score 82.0076
Status Not validated
Chromosome 14
Chromosomal Location (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 19417330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 66 (S66L)
Ref Sequence ENSEMBL: ENSMUSP00000137127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177817]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000177817
AA Change: S66L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137127
Gene: ENSMUSG00000095280
AA Change: S66L

DomainStartEndE-ValueType
internal_repeat_1 1 19 1.11e-9 PROSPERO
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 135 1.11e-9 PROSPERO
transmembrane domain 152 174 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (126/137)
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,561,599 (GRCm39) probably benign Het
Alpk2 G A 18: 65,439,450 (GRCm39) H648Y possibly damaging Het
Ambp A G 4: 63,062,502 (GRCm39) Y246H probably damaging Het
Amz1 T C 5: 140,735,088 (GRCm39) probably null Het
Anks6 G A 4: 47,027,109 (GRCm39) T703I probably damaging Het
Armc2 A G 10: 41,823,883 (GRCm39) probably benign Het
Atp7b T A 8: 22,484,672 (GRCm39) I1347F probably damaging Het
Atp8a1 C T 5: 67,779,945 (GRCm39) W1149* probably null Het
Auh A G 13: 52,995,046 (GRCm39) I173T probably damaging Het
Axin2 T C 11: 108,814,829 (GRCm39) L239P possibly damaging Het
Bbs1 A T 19: 4,949,287 (GRCm39) F257L possibly damaging Het
Cacna2d2 C T 9: 107,401,867 (GRCm39) P774L probably damaging Het
Card6 A G 15: 5,137,788 (GRCm39) L22P probably damaging Het
Ccdc171 C T 4: 83,579,946 (GRCm39) Het
Ccn2 T C 10: 24,471,988 (GRCm39) V70A probably damaging Het
Cdc14a T A 3: 116,122,310 (GRCm39) N219I possibly damaging Het
Cfap65 G T 1: 74,967,501 (GRCm39) N192K probably benign Het
Col14a1 T C 15: 55,312,272 (GRCm39) probably benign Het
Col5a1 A G 2: 27,914,665 (GRCm39) T94A probably benign Het
Col6a5 T C 9: 105,759,113 (GRCm39) N2031S probably damaging Het
Col7a1 T C 9: 108,794,989 (GRCm39) probably benign Het
Cyld T C 8: 89,473,543 (GRCm39) S739P probably damaging Het
Dbr1 A G 9: 99,466,072 (GRCm39) probably null Het
Dip2b T C 15: 100,100,233 (GRCm39) L1267P probably damaging Het
Dolk A G 2: 30,175,586 (GRCm39) M153T probably benign Het
Duxf1 C T 10: 58,060,704 (GRCm39) E17K possibly damaging Het
Duxf1 G A 10: 58,060,136 (GRCm39) probably benign Het
Duxf1 A G 10: 58,059,276 (GRCm39) C493R probably benign Het
Duxf3 A C 10: 58,067,498 (GRCm39) S27A probably benign Het
Eef1d C T 15: 75,775,581 (GRCm39) R26H probably benign Homo
Efcab5 C T 11: 77,028,517 (GRCm39) Het
Epc1 T C 18: 6,449,246 (GRCm39) D467G probably damaging Het
Fancm T G 12: 65,152,196 (GRCm39) M884R probably benign Het
Fbxo24 G T 5: 137,620,164 (GRCm39) H15N probably damaging Het
Frem1 A G 4: 82,924,045 (GRCm39) F305L probably damaging Het
Fstl5 A G 3: 76,567,006 (GRCm39) D550G probably damaging Het
Gcnt3 T G 9: 69,941,326 (GRCm39) K414T possibly damaging Het
Gm10718 A T 9: 3,024,417 (GRCm39) T134S probably benign Het
Gm10722 A G,C 9: 3,001,414 (GRCm39) probably benign Het
Gm10800 T C 2: 98,497,163 (GRCm39) R152G probably benign Homo
Gm10800 C A 2: 98,497,250 (GRCm39) V123F probably benign Homo
Gm10800 A C 2: 98,496,893 (GRCm39) F220C probably benign Het
Gm10801 A G 2: 98,492,648 (GRCm39) R23G probably benign Homo
Gm11168 C T 9: 3,004,605 (GRCm39) P49S probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,194,000 (GRCm39) probably benign Het
Hmgcr A G 13: 96,795,562 (GRCm39) Y336H probably damaging Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Homo
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Homo
Igf2bp3 A C 6: 49,094,084 (GRCm39) probably null Het
Kcnb2 A T 1: 15,383,200 (GRCm39) K175N possibly damaging Het
Kdr T C 5: 76,102,631 (GRCm39) probably benign Het
Kif5c A G 2: 49,584,044 (GRCm39) K160E probably damaging Het
Kif7 A T 7: 79,360,817 (GRCm39) V186E probably damaging Het
Krt16 T A 11: 100,139,575 (GRCm39) T48S unknown Het
Liph T C 16: 21,814,119 (GRCm39) M1V probably null Het
Mctp2 A G 7: 71,740,005 (GRCm39) F795S probably damaging Het
Muc4 T A 16: 32,755,699 (GRCm38) probably benign Homo
Muc4 C G 16: 32,755,676 (GRCm38) probably benign Homo
Muc4 T A 16: 32,755,684 (GRCm38) probably benign Homo
Myo15a G T 11: 60,373,953 (GRCm39) A1267S probably damaging Het
Myo15a T C 11: 60,386,280 (GRCm39) Y1802H probably damaging Het
Myo7b G A 18: 32,094,259 (GRCm39) T1963I probably benign Het
Nadk2 TG T 15: 9,100,232 (GRCm39) probably null Homo
Naip5 T C 13: 100,356,268 (GRCm39) N1116D probably benign Het
Naip5 T C 13: 100,356,247 (GRCm39) R1123G probably benign Het
Nap1l1 A G 10: 111,322,583 (GRCm39) D61G probably null Het
Napsa A T 7: 44,230,875 (GRCm39) T81S probably damaging Het
Ngp T C 9: 110,251,337 (GRCm39) probably benign Het
Nktr T A 9: 121,570,687 (GRCm39) V143E probably damaging Het
Obscn A G 11: 58,957,890 (GRCm39) probably null Het
Or10ag53 G A 2: 87,082,973 (GRCm39) A231T probably benign Het
Or11i1 T C 3: 106,729,282 (GRCm39) I198V probably benign Het
Or4f56 G A 2: 111,703,649 (GRCm39) L184F probably benign Het
Or52ab2 C T 7: 102,970,076 (GRCm39) R153* probably null Het
Or52d3 G A 7: 104,229,237 (GRCm39) R128Q probably damaging Het
Or6p1 A G 1: 174,258,390 (GRCm39) Y132C probably damaging Het
Paip2b A G 6: 83,785,823 (GRCm39) Y136H probably damaging Het
Pde2a G T 7: 101,160,361 (GRCm39) R845L probably damaging Het
Pgap2 A G 7: 101,886,405 (GRCm39) Y197C possibly damaging Het
Phf11b A G 14: 59,560,611 (GRCm39) probably benign Het
Pitpnm2 A T 5: 124,269,178 (GRCm39) D481E probably benign Het
Pxk A T 14: 8,152,130 (GRCm38) H482L probably benign Het
Rad50 A G 11: 53,585,726 (GRCm39) probably null Het
Rbmyf1 T A Y: 2,787,132 (GRCm39) N228Y probably benign Het
Rbmyf5 T C Y: 3,297,411 (GRCm39) H235R probably benign Het
Rbmyf6 C T Y: 3,328,944 (GRCm39) A241T possibly damaging Het
Rnf220 A G 4: 117,134,566 (GRCm39) probably null Het
Saxo5 T A 8: 3,526,062 (GRCm39) S72T possibly damaging Het
Selenbp1 C T 3: 94,844,607 (GRCm39) T88M probably damaging Het
Sft2d1 T C 17: 8,609,863 (GRCm39) I104T possibly damaging Het
Sik1 A G 17: 32,070,305 (GRCm39) S135P probably damaging Het
Slc16a3 T C 11: 120,846,172 (GRCm39) F34L probably damaging Het
Slc6a20b T C 9: 123,612,126 (GRCm38) N85S probably benign Homo
Snrnp27 T C 6: 86,659,893 (GRCm39) R34G unknown Het
Sos2 T C 12: 69,664,851 (GRCm39) H393R probably benign Het
Sp110 C T 1: 85,513,971 (GRCm39) R262Q probably benign Het
Sp110 T C 1: 85,513,975 (GRCm39) R261G probably benign Het
Sp140 T A 1: 85,528,893 (GRCm39) Y5N probably benign Het
Sp140 A G 1: 85,570,942 (GRCm39) S461G probably benign Het
Sp140 G C 1: 85,538,603 (GRCm39) K113N probably benign Het
Sp140l1 G A 1: 85,077,341 (GRCm39) A75V probably benign Het
Sp140l2 A C 1: 85,223,395 (GRCm39) probably benign Het
Speer4a2 A T 5: 26,291,485 (GRCm39) F107Y probably benign Het
Speer4a2 C G 5: 26,294,093 (GRCm39) W28C probably damaging Het
Ssrp1 G A 2: 84,868,760 (GRCm39) V40M probably damaging Het
Tada2a T C 11: 83,970,563 (GRCm39) E202G probably damaging Het
Tcf20 C A 15: 82,735,785 (GRCm39) A1889S probably damaging Het
Tdrd12 A T 7: 35,180,528 (GRCm39) Y828* probably null Het
Tlr2 T A 3: 83,745,756 (GRCm39) D109V probably benign Het
Tomm40 G A 7: 19,437,016 (GRCm39) T17M probably damaging Het
Tsga10ip T C 19: 5,440,161 (GRCm39) T135A possibly damaging Het
Tspan8 G A 10: 115,653,515 (GRCm39) V4M probably damaging Het
Ttc28 A T 5: 111,040,719 (GRCm39) T36S probably benign Het
Ugt1a6b G A 1: 88,146,112 (GRCm39) R519Q probably damaging Het
Ugt1a6b TTCA T 1: 88,143,880 (GRCm39) probably benign Het
Ugt1a6b G A 1: 88,143,976 (GRCm39) A199T probably damaging Het
Unc45a A G 7: 79,976,109 (GRCm39) M790T possibly damaging Het
Vav3 T C 3: 109,571,751 (GRCm39) probably null Het
Vcpkmt G A 12: 69,629,552 (GRCm39) S70L probably benign Het
Vmn1r3 C T 4: 3,184,691 (GRCm39) M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 (GRCm39) V178I probably benign Het
Vmn2r66 T C 7: 84,644,301 (GRCm39) Q703R probably damaging Het
Vmn2r98 G T 17: 19,301,223 (GRCm39) V742F probably benign Het
Wfdc8 A G 2: 164,439,696 (GRCm39) S229P possibly damaging Het
Xpo4 A T 14: 57,822,068 (GRCm39) C1083S probably null Het
Zbtb38 T C 9: 96,568,369 (GRCm39) D905G probably damaging Het
Zbtb8b A G 4: 129,321,308 (GRCm39) *518Q probably null Het
Zfp600 TC T 4: 146,131,802 (GRCm39) probably null Het
Zfp992 C T 4: 146,550,569 (GRCm39) P97S probably benign Het
Other mutations in Gm21738
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm21738 APN 14 19,418,885 (GRCm38) missense probably benign
IGL01010:Gm21738 APN 14 19,417,361 (GRCm38) missense probably benign 0.03
IGL01018:Gm21738 APN 14 19,418,856 (GRCm38) missense probably benign 0.39
IGL01865:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01869:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01873:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01877:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01878:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01879:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01880:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01882:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01883:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01884:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01885:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01886:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01888:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01891:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01892:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01893:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01894:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01895:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01896:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01898:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01899:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01900:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01901:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01902:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01903:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01904:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01905:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01906:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01908:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01909:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01910:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01911:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01912:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01913:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01914:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01915:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01916:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01917:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01918:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01919:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01922:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01923:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01924:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01925:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01926:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01932:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01940:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
IGL01949:Gm21738 APN 14 19,416,979 (GRCm38) missense probably benign 0.01
PIT4142001:Gm21738 UTSW 14 19,417,330 (GRCm38) missense probably benign 0.00
R0831:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R0831:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R0976:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R1029:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R1146:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R1231:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R1231:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R1402:Gm21738 UTSW 14 19,415,963 (GRCm38) missense probably benign
R1402:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R1638:Gm21738 UTSW 14 19,418,908 (GRCm38) missense probably benign
R1874:Gm21738 UTSW 14 19,418,824 (GRCm38) missense possibly damaging 0.64
R4392:Gm21738 UTSW 14 19,417,178 (GRCm38) missense probably benign
R4393:Gm21738 UTSW 14 19,417,178 (GRCm38) missense probably benign
R5049:Gm21738 UTSW 14 19,415,957 (GRCm38) missense probably benign 0.01
R5257:Gm21738 UTSW 14 19,415,942 (GRCm38) missense probably benign
R6756:Gm21738 UTSW 14 19,418,824 (GRCm38) missense possibly damaging 0.64
R6915:Gm21738 UTSW 14 19,415,933 (GRCm38) missense probably benign
V5622:Gm21738 UTSW 14 19,417,180 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGGACCTGGAATATGGCGA -3'
(R):5'- GTTCGAGGTCCTACAGTTTGCA -3'

Sequencing Primer
(F):5'- CCTGGAATATGGCGAGAAAACTG -3'
(R):5'- CAAGTCCTCGAGTGGATGTTTCTC -3'
Posted On 2018-06-12