Incidental Mutation 'PIT4131001:Xpo4'
ID 523256
Institutional Source Beutler Lab
Gene Symbol Xpo4
Ensembl Gene ENSMUSG00000021952
Gene Name exportin 4
Synonyms B430309A01Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.808) question?
Stock # PIT4131001 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 57814978-57902887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57822068 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 1083 (C1083S)
Ref Sequence ENSEMBL: ENSMUSP00000133280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174545]
AlphaFold Q9ESJ0
Predicted Effect probably null
Transcript: ENSMUST00000089482
AA Change: C1083S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: C1083S

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 954 1144 6.3e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174545
AA Change: C1083S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: C1083S

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 952 1143 5.2e-9 PFAM
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (126/137)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,561,599 (GRCm39) probably benign Het
Alpk2 G A 18: 65,439,450 (GRCm39) H648Y possibly damaging Het
Ambp A G 4: 63,062,502 (GRCm39) Y246H probably damaging Het
Amz1 T C 5: 140,735,088 (GRCm39) probably null Het
Anks6 G A 4: 47,027,109 (GRCm39) T703I probably damaging Het
Armc2 A G 10: 41,823,883 (GRCm39) probably benign Het
Atp7b T A 8: 22,484,672 (GRCm39) I1347F probably damaging Het
Atp8a1 C T 5: 67,779,945 (GRCm39) W1149* probably null Het
Auh A G 13: 52,995,046 (GRCm39) I173T probably damaging Het
Axin2 T C 11: 108,814,829 (GRCm39) L239P possibly damaging Het
Bbs1 A T 19: 4,949,287 (GRCm39) F257L possibly damaging Het
Cacna2d2 C T 9: 107,401,867 (GRCm39) P774L probably damaging Het
Card6 A G 15: 5,137,788 (GRCm39) L22P probably damaging Het
Ccdc171 C T 4: 83,579,946 (GRCm39) Het
Ccn2 T C 10: 24,471,988 (GRCm39) V70A probably damaging Het
Cdc14a T A 3: 116,122,310 (GRCm39) N219I possibly damaging Het
Cfap65 G T 1: 74,967,501 (GRCm39) N192K probably benign Het
Col14a1 T C 15: 55,312,272 (GRCm39) probably benign Het
Col5a1 A G 2: 27,914,665 (GRCm39) T94A probably benign Het
Col6a5 T C 9: 105,759,113 (GRCm39) N2031S probably damaging Het
Col7a1 T C 9: 108,794,989 (GRCm39) probably benign Het
Cyld T C 8: 89,473,543 (GRCm39) S739P probably damaging Het
Dbr1 A G 9: 99,466,072 (GRCm39) probably null Het
Dip2b T C 15: 100,100,233 (GRCm39) L1267P probably damaging Het
Dolk A G 2: 30,175,586 (GRCm39) M153T probably benign Het
Duxf1 C T 10: 58,060,704 (GRCm39) E17K possibly damaging Het
Duxf1 G A 10: 58,060,136 (GRCm39) probably benign Het
Duxf1 A G 10: 58,059,276 (GRCm39) C493R probably benign Het
Duxf3 A C 10: 58,067,498 (GRCm39) S27A probably benign Het
Eef1d C T 15: 75,775,581 (GRCm39) R26H probably benign Homo
Efcab5 C T 11: 77,028,517 (GRCm39) Het
Epc1 T C 18: 6,449,246 (GRCm39) D467G probably damaging Het
Fancm T G 12: 65,152,196 (GRCm39) M884R probably benign Het
Fbxo24 G T 5: 137,620,164 (GRCm39) H15N probably damaging Het
Frem1 A G 4: 82,924,045 (GRCm39) F305L probably damaging Het
Fstl5 A G 3: 76,567,006 (GRCm39) D550G probably damaging Het
Gcnt3 T G 9: 69,941,326 (GRCm39) K414T possibly damaging Het
Gm10718 A T 9: 3,024,417 (GRCm39) T134S probably benign Het
Gm10722 A G,C 9: 3,001,414 (GRCm39) probably benign Het
Gm10800 T C 2: 98,497,163 (GRCm39) R152G probably benign Homo
Gm10800 C A 2: 98,497,250 (GRCm39) V123F probably benign Homo
Gm10800 A C 2: 98,496,893 (GRCm39) F220C probably benign Het
Gm10801 A G 2: 98,492,648 (GRCm39) R23G probably benign Homo
Gm11168 C T 9: 3,004,605 (GRCm39) P49S probably benign Het
Gm21738 G A 14: 19,417,330 (GRCm38) S66L probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,194,000 (GRCm39) probably benign Het
Hmgcr A G 13: 96,795,562 (GRCm39) Y336H probably damaging Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Homo
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Homo
Igf2bp3 A C 6: 49,094,084 (GRCm39) probably null Het
Kcnb2 A T 1: 15,383,200 (GRCm39) K175N possibly damaging Het
Kdr T C 5: 76,102,631 (GRCm39) probably benign Het
Kif5c A G 2: 49,584,044 (GRCm39) K160E probably damaging Het
Kif7 A T 7: 79,360,817 (GRCm39) V186E probably damaging Het
Krt16 T A 11: 100,139,575 (GRCm39) T48S unknown Het
Liph T C 16: 21,814,119 (GRCm39) M1V probably null Het
Mctp2 A G 7: 71,740,005 (GRCm39) F795S probably damaging Het
Muc4 T A 16: 32,755,699 (GRCm38) probably benign Homo
Muc4 C G 16: 32,755,676 (GRCm38) probably benign Homo
Muc4 T A 16: 32,755,684 (GRCm38) probably benign Homo
Myo15a G T 11: 60,373,953 (GRCm39) A1267S probably damaging Het
Myo15a T C 11: 60,386,280 (GRCm39) Y1802H probably damaging Het
Myo7b G A 18: 32,094,259 (GRCm39) T1963I probably benign Het
Nadk2 TG T 15: 9,100,232 (GRCm39) probably null Homo
Naip5 T C 13: 100,356,268 (GRCm39) N1116D probably benign Het
Naip5 T C 13: 100,356,247 (GRCm39) R1123G probably benign Het
Nap1l1 A G 10: 111,322,583 (GRCm39) D61G probably null Het
Napsa A T 7: 44,230,875 (GRCm39) T81S probably damaging Het
Ngp T C 9: 110,251,337 (GRCm39) probably benign Het
Nktr T A 9: 121,570,687 (GRCm39) V143E probably damaging Het
Obscn A G 11: 58,957,890 (GRCm39) probably null Het
Or10ag53 G A 2: 87,082,973 (GRCm39) A231T probably benign Het
Or11i1 T C 3: 106,729,282 (GRCm39) I198V probably benign Het
Or4f56 G A 2: 111,703,649 (GRCm39) L184F probably benign Het
Or52ab2 C T 7: 102,970,076 (GRCm39) R153* probably null Het
Or52d3 G A 7: 104,229,237 (GRCm39) R128Q probably damaging Het
Or6p1 A G 1: 174,258,390 (GRCm39) Y132C probably damaging Het
Paip2b A G 6: 83,785,823 (GRCm39) Y136H probably damaging Het
Pde2a G T 7: 101,160,361 (GRCm39) R845L probably damaging Het
Pgap2 A G 7: 101,886,405 (GRCm39) Y197C possibly damaging Het
Phf11b A G 14: 59,560,611 (GRCm39) probably benign Het
Pitpnm2 A T 5: 124,269,178 (GRCm39) D481E probably benign Het
Pxk A T 14: 8,152,130 (GRCm38) H482L probably benign Het
Rad50 A G 11: 53,585,726 (GRCm39) probably null Het
Rbmyf1 T A Y: 2,787,132 (GRCm39) N228Y probably benign Het
Rbmyf5 T C Y: 3,297,411 (GRCm39) H235R probably benign Het
Rbmyf6 C T Y: 3,328,944 (GRCm39) A241T possibly damaging Het
Rnf220 A G 4: 117,134,566 (GRCm39) probably null Het
Saxo5 T A 8: 3,526,062 (GRCm39) S72T possibly damaging Het
Selenbp1 C T 3: 94,844,607 (GRCm39) T88M probably damaging Het
Sft2d1 T C 17: 8,609,863 (GRCm39) I104T possibly damaging Het
Sik1 A G 17: 32,070,305 (GRCm39) S135P probably damaging Het
Slc16a3 T C 11: 120,846,172 (GRCm39) F34L probably damaging Het
Slc6a20b T C 9: 123,612,126 (GRCm38) N85S probably benign Homo
Snrnp27 T C 6: 86,659,893 (GRCm39) R34G unknown Het
Sos2 T C 12: 69,664,851 (GRCm39) H393R probably benign Het
Sp110 C T 1: 85,513,971 (GRCm39) R262Q probably benign Het
Sp110 T C 1: 85,513,975 (GRCm39) R261G probably benign Het
Sp140 T A 1: 85,528,893 (GRCm39) Y5N probably benign Het
Sp140 A G 1: 85,570,942 (GRCm39) S461G probably benign Het
Sp140 G C 1: 85,538,603 (GRCm39) K113N probably benign Het
Sp140l1 G A 1: 85,077,341 (GRCm39) A75V probably benign Het
Sp140l2 A C 1: 85,223,395 (GRCm39) probably benign Het
Speer4a2 C G 5: 26,294,093 (GRCm39) W28C probably damaging Het
Speer4a2 A T 5: 26,291,485 (GRCm39) F107Y probably benign Het
Ssrp1 G A 2: 84,868,760 (GRCm39) V40M probably damaging Het
Tada2a T C 11: 83,970,563 (GRCm39) E202G probably damaging Het
Tcf20 C A 15: 82,735,785 (GRCm39) A1889S probably damaging Het
Tdrd12 A T 7: 35,180,528 (GRCm39) Y828* probably null Het
Tlr2 T A 3: 83,745,756 (GRCm39) D109V probably benign Het
Tomm40 G A 7: 19,437,016 (GRCm39) T17M probably damaging Het
Tsga10ip T C 19: 5,440,161 (GRCm39) T135A possibly damaging Het
Tspan8 G A 10: 115,653,515 (GRCm39) V4M probably damaging Het
Ttc28 A T 5: 111,040,719 (GRCm39) T36S probably benign Het
Ugt1a6b G A 1: 88,146,112 (GRCm39) R519Q probably damaging Het
Ugt1a6b TTCA T 1: 88,143,880 (GRCm39) probably benign Het
Ugt1a6b G A 1: 88,143,976 (GRCm39) A199T probably damaging Het
Unc45a A G 7: 79,976,109 (GRCm39) M790T possibly damaging Het
Vav3 T C 3: 109,571,751 (GRCm39) probably null Het
Vcpkmt G A 12: 69,629,552 (GRCm39) S70L probably benign Het
Vmn1r3 C T 4: 3,184,691 (GRCm39) M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 (GRCm39) V178I probably benign Het
Vmn2r66 T C 7: 84,644,301 (GRCm39) Q703R probably damaging Het
Vmn2r98 G T 17: 19,301,223 (GRCm39) V742F probably benign Het
Wfdc8 A G 2: 164,439,696 (GRCm39) S229P possibly damaging Het
Zbtb38 T C 9: 96,568,369 (GRCm39) D905G probably damaging Het
Zbtb8b A G 4: 129,321,308 (GRCm39) *518Q probably null Het
Zfp600 TC T 4: 146,131,802 (GRCm39) probably null Het
Zfp992 C T 4: 146,550,569 (GRCm39) P97S probably benign Het
Other mutations in Xpo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Xpo4 APN 14 57,841,855 (GRCm39) missense probably benign
IGL02537:Xpo4 APN 14 57,831,290 (GRCm39) missense probably benign
IGL02554:Xpo4 APN 14 57,827,545 (GRCm39) missense probably benign 0.00
IGL02826:Xpo4 APN 14 57,866,877 (GRCm39) missense possibly damaging 0.50
IGL03071:Xpo4 APN 14 57,855,685 (GRCm39) missense possibly damaging 0.66
R0245:Xpo4 UTSW 14 57,867,697 (GRCm39) missense probably damaging 1.00
R0546:Xpo4 UTSW 14 57,850,731 (GRCm39) missense probably benign 0.07
R0606:Xpo4 UTSW 14 57,875,665 (GRCm39) unclassified probably benign
R0761:Xpo4 UTSW 14 57,850,840 (GRCm39) missense probably damaging 0.99
R1775:Xpo4 UTSW 14 57,841,129 (GRCm39) missense probably benign
R1853:Xpo4 UTSW 14 57,823,364 (GRCm39) missense possibly damaging 0.72
R1923:Xpo4 UTSW 14 57,828,328 (GRCm39) missense probably damaging 0.98
R2007:Xpo4 UTSW 14 57,824,101 (GRCm39) missense probably null 0.19
R2035:Xpo4 UTSW 14 57,823,383 (GRCm39) missense possibly damaging 0.57
R2174:Xpo4 UTSW 14 57,827,547 (GRCm39) missense probably damaging 1.00
R2421:Xpo4 UTSW 14 57,866,960 (GRCm39) missense probably benign 0.00
R2937:Xpo4 UTSW 14 57,841,897 (GRCm39) missense probably benign 0.03
R2938:Xpo4 UTSW 14 57,841,897 (GRCm39) missense probably benign 0.03
R4066:Xpo4 UTSW 14 57,825,511 (GRCm39) missense probably benign 0.07
R4086:Xpo4 UTSW 14 57,880,490 (GRCm39) intron probably benign
R4373:Xpo4 UTSW 14 57,828,479 (GRCm39) nonsense probably null
R4620:Xpo4 UTSW 14 57,867,782 (GRCm39) missense probably damaging 1.00
R4703:Xpo4 UTSW 14 57,827,565 (GRCm39) missense probably benign 0.01
R4755:Xpo4 UTSW 14 57,855,638 (GRCm39) missense probably benign 0.01
R4831:Xpo4 UTSW 14 57,827,559 (GRCm39) missense probably damaging 1.00
R4905:Xpo4 UTSW 14 57,875,746 (GRCm39) missense possibly damaging 0.70
R4943:Xpo4 UTSW 14 57,875,697 (GRCm39) missense possibly damaging 0.68
R5074:Xpo4 UTSW 14 57,822,098 (GRCm39) missense probably benign 0.02
R5279:Xpo4 UTSW 14 57,850,866 (GRCm39) missense probably benign 0.37
R5375:Xpo4 UTSW 14 57,875,764 (GRCm39) missense probably damaging 0.99
R5690:Xpo4 UTSW 14 57,828,446 (GRCm39) missense probably benign 0.03
R5936:Xpo4 UTSW 14 57,880,956 (GRCm39) missense probably benign
R6393:Xpo4 UTSW 14 57,875,770 (GRCm39) missense probably damaging 1.00
R6824:Xpo4 UTSW 14 57,850,860 (GRCm39) missense probably damaging 1.00
R6893:Xpo4 UTSW 14 57,819,767 (GRCm39) missense probably benign
R6923:Xpo4 UTSW 14 57,841,168 (GRCm39) missense probably benign 0.19
R7028:Xpo4 UTSW 14 57,834,508 (GRCm39) missense probably benign 0.22
R7442:Xpo4 UTSW 14 57,867,680 (GRCm39) missense probably benign 0.00
R7469:Xpo4 UTSW 14 57,835,436 (GRCm39) missense probably benign
R7490:Xpo4 UTSW 14 57,840,078 (GRCm39) frame shift probably null
R7622:Xpo4 UTSW 14 57,834,468 (GRCm39) missense possibly damaging 0.94
R7667:Xpo4 UTSW 14 57,827,416 (GRCm39) missense probably damaging 0.97
R7789:Xpo4 UTSW 14 57,850,806 (GRCm39) missense probably benign 0.00
R7895:Xpo4 UTSW 14 57,840,048 (GRCm39) missense probably benign 0.03
R8000:Xpo4 UTSW 14 57,827,403 (GRCm39) missense probably damaging 1.00
R8372:Xpo4 UTSW 14 57,835,341 (GRCm39) critical splice donor site probably null
R8395:Xpo4 UTSW 14 57,885,924 (GRCm39) missense probably benign 0.01
R8420:Xpo4 UTSW 14 57,841,913 (GRCm39) missense probably damaging 0.99
R8836:Xpo4 UTSW 14 57,902,367 (GRCm39) missense probably benign 0.03
R8841:Xpo4 UTSW 14 57,835,413 (GRCm39) missense probably damaging 0.97
R8989:Xpo4 UTSW 14 57,828,475 (GRCm39) missense probably benign 0.00
R9229:Xpo4 UTSW 14 57,851,156 (GRCm39) missense probably benign
R9374:Xpo4 UTSW 14 57,828,512 (GRCm39) missense possibly damaging 0.94
R9551:Xpo4 UTSW 14 57,828,512 (GRCm39) missense possibly damaging 0.94
R9628:Xpo4 UTSW 14 57,842,630 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGGCTCCTAACAGAGACG -3'
(R):5'- TTGTTTCAGACCAGAAAGGGAC -3'

Sequencing Primer
(F):5'- CTCCTAACAGAGACGGGATCTTTTG -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On 2018-06-12