Incidental Mutation 'PIT4131001:Tcf20'
ID 523262
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Name transcription factor 20
Synonyms stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock # PIT4131001 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 82808436-82987872 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 82851584 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 1889 (A1889S)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510]
AlphaFold Q9EPQ8
Predicted Effect probably damaging
Transcript: ENSMUST00000048966
AA Change: A1889S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: A1889S

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109510
AA Change: A1889S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: A1889S

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 92% (126/137)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,719,806 probably benign Het
A530032D15Rik G A 1: 85,099,620 A75V probably benign Het
Alpk2 G A 18: 65,306,379 H648Y possibly damaging Het
Ambp A G 4: 63,144,265 Y246H probably damaging Het
Amz1 T C 5: 140,749,333 probably null Het
Anks6 G A 4: 47,027,109 T703I probably damaging Het
Armc2 A G 10: 41,947,887 probably benign Het
Atp7b T A 8: 21,994,656 I1347F probably damaging Het
Atp8a1 C T 5: 67,622,602 W1149* probably null Het
Auh A G 13: 52,841,010 I173T probably damaging Het
AW822073 A G 10: 58,223,454 C493R probably benign Het
AW822073 G A 10: 58,224,314 probably benign Het
AW822073 C T 10: 58,224,882 E17K possibly damaging Het
Axin2 T C 11: 108,924,003 L239P possibly damaging Het
Bbs1 A T 19: 4,899,259 F257L possibly damaging Het
C130026I21Rik A C 1: 85,245,674 probably benign Het
Cacna2d2 C T 9: 107,524,668 P774L probably damaging Het
Card6 A G 15: 5,108,306 L22P probably damaging Het
Ccdc171 C T 4: 83,661,709 Het
Cdc14a T A 3: 116,328,661 N219I possibly damaging Het
Cfap65 G T 1: 74,928,342 N192K probably benign Het
Col14a1 T C 15: 55,448,876 probably benign Het
Col5a1 A G 2: 28,024,653 T94A probably benign Het
Col6a5 T C 9: 105,881,914 N2031S probably damaging Het
Col7a1 T C 9: 108,965,921 probably benign Het
Ctgf T C 10: 24,596,090 V70A probably damaging Het
Cyld T C 8: 88,746,915 S739P probably damaging Het
Dbr1 A G 9: 99,584,019 probably null Het
Dip2b T C 15: 100,202,352 L1267P probably damaging Het
Dolk A G 2: 30,285,574 M153T probably benign Het
Duxf3 A C 10: 58,231,676 S27A probably benign Het
Eef1d C T 15: 75,903,732 R26H probably benign Homo
Efcab5 C T 11: 77,137,691 Het
Epc1 T C 18: 6,449,246 D467G probably damaging Het
Fancm T G 12: 65,105,422 M884R probably benign Het
Fbxo24 G T 5: 137,621,902 H15N probably damaging Het
Frem1 A G 4: 83,005,808 F305L probably damaging Het
Fstl5 A G 3: 76,659,699 D550G probably damaging Het
Gcnt3 T G 9: 70,034,044 K414T possibly damaging Het
Gm10471 A T 5: 26,086,487 F107Y probably benign Het
Gm10471 C G 5: 26,089,095 W28C probably damaging Het
Gm10718 A T 9: 3,024,417 T134S probably benign Het
Gm10722 A G,C 9: 3,001,414 probably benign Het
Gm10800 A C 2: 98,666,548 F220C probably benign Het
Gm10800 T C 2: 98,666,818 R152G probably benign Homo
Gm10800 C A 2: 98,666,905 V123F probably benign Homo
Gm10801 A G 2: 98,662,303 R23G probably benign Homo
Gm11168 C T 9: 3,004,605 P49S probably benign Het
Gm21677 T C Y: 3,297,411 H235R probably benign Het
Gm21693 C T Y: 3,328,944 A241T possibly damaging Het
Gm21738 G A 14: 19,417,330 S66L probably benign Het
Gm4064 T A Y: 2,787,132 N228Y probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTG T 1: 88,266,278 probably benign Het
Hmgcr A G 13: 96,659,054 Y336H probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Homo
Hoxa13 G C 6: 52,260,648 probably benign Homo
Igf2bp3 A C 6: 49,117,150 probably null Het
Kcnb2 A T 1: 15,312,976 K175N possibly damaging Het
Kdr T C 5: 75,941,971 probably benign Het
Kif5c A G 2: 49,694,032 K160E probably damaging Het
Kif7 A T 7: 79,711,069 V186E probably damaging Het
Krt16 T A 11: 100,248,749 T48S unknown Het
Liph T C 16: 21,995,369 M1V probably null Het
Mctp2 A G 7: 72,090,257 F795S probably damaging Het
Muc4 C G 16: 32,755,676 probably benign Homo
Muc4 T A 16: 32,755,684 probably benign Homo
Muc4 T A 16: 32,755,699 probably benign Homo
Myo15 G T 11: 60,483,127 A1267S probably damaging Het
Myo15 T C 11: 60,495,454 Y1802H probably damaging Het
Myo7b G A 18: 31,961,206 T1963I probably benign Het
Nadk2 TG T 15: 9,100,143 probably null Homo
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Naip5 T C 13: 100,219,760 N1116D probably benign Het
Nap1l1 A G 10: 111,486,722 D61G probably null Het
Napsa A T 7: 44,581,451 T81S probably damaging Het
Ngp T C 9: 110,422,269 probably benign Het
Nktr T A 9: 121,741,621 V143E probably damaging Het
Obscn A G 11: 59,067,064 probably null Het
Olfr1115 G A 2: 87,252,629 A231T probably benign Het
Olfr1305 G A 2: 111,873,304 L184F probably benign Het
Olfr266 T C 3: 106,821,966 I198V probably benign Het
Olfr414 A G 1: 174,430,824 Y132C probably damaging Het
Olfr597 C T 7: 103,320,869 R153* probably null Het
Olfr653 G A 7: 104,580,030 R128Q probably damaging Het
Paip2b A G 6: 83,808,841 Y136H probably damaging Het
Pde2a G T 7: 101,511,154 R845L probably damaging Het
Pgap2 A G 7: 102,237,198 Y197C possibly damaging Het
Phf11b A G 14: 59,323,162 probably benign Het
Pitpnm2 A T 5: 124,131,115 D481E probably benign Het
Pxk A T 14: 8,152,130 H482L probably benign Het
Rad50 A G 11: 53,694,899 probably null Het
Rnf220 A G 4: 117,277,369 probably null Het
Selenbp1 C T 3: 94,937,296 T88M probably damaging Het
Sft2d1 T C 17: 8,391,031 I104T possibly damaging Het
Sik1 A G 17: 31,851,331 S135P probably damaging Het
Slc16a3 T C 11: 120,955,346 F34L probably damaging Het
Slc6a20b T C 9: 123,612,126 N85S probably benign Homo
Snrnp27 T C 6: 86,682,911 R34G unknown Het
Sos2 T C 12: 69,618,077 H393R probably benign Het
Sp110 C T 1: 85,586,250 R262Q probably benign Het
Sp110 T C 1: 85,586,254 R261G probably benign Het
Sp140 T A 1: 85,601,172 Y5N probably benign Het
Sp140 G C 1: 85,610,882 K113N probably benign Het
Sp140 A G 1: 85,643,221 S461G probably benign Het
Ssrp1 G A 2: 85,038,416 V40M probably damaging Het
Tada2a T C 11: 84,079,737 E202G probably damaging Het
Tdrd12 A T 7: 35,481,103 Y828* probably null Het
Tex45 T A 8: 3,476,062 S72T possibly damaging Het
Tlr2 T A 3: 83,838,449 D109V probably benign Het
Tomm40 G A 7: 19,703,091 T17M probably damaging Het
Tsga10ip T C 19: 5,390,133 T135A possibly damaging Het
Tspan8 G A 10: 115,817,610 V4M probably damaging Het
Ttc28 A T 5: 110,892,853 T36S probably benign Het
Ugt1a6b TTCA T 1: 88,216,158 probably benign Het
Ugt1a6b G A 1: 88,216,254 A199T probably damaging Het
Ugt1a6b G A 1: 88,218,390 R519Q probably damaging Het
Unc45a A G 7: 80,326,361 M790T possibly damaging Het
Vav3 T C 3: 109,664,435 probably null Het
Vcpkmt G A 12: 69,582,778 S70L probably benign Het
Vmn1r3 C T 4: 3,184,691 M205I probably damaging Het
Vmn1r3 C T 4: 3,184,774 V178I probably benign Het
Vmn2r66 T C 7: 84,995,093 Q703R probably damaging Het
Vmn2r98 G T 17: 19,080,961 V742F probably benign Het
Wfdc8 A G 2: 164,597,776 S229P possibly damaging Het
Xpo4 A T 14: 57,584,611 C1083S probably null Het
Zbtb38 T C 9: 96,686,316 D905G probably damaging Het
Zbtb8b A G 4: 129,427,515 *518Q probably null Het
Zfp600 TC T 4: 146,195,232 probably null Het
Zfp992 C T 4: 146,466,112 P97S probably benign Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82854895 missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82857142 missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82852756 missense probably benign 0.41
IGL00576:Tcf20 APN 15 82856075 missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82853900 missense probably benign
IGL01670:Tcf20 APN 15 82855363 missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82857160 missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82856008 missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82852966 missense probably benign
IGL01834:Tcf20 APN 15 82855697 missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82855155 missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82853459 missense probably benign 0.28
IGL02731:Tcf20 APN 15 82853237 missense probably benign 0.00
IGL02739:Tcf20 APN 15 82856080 missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82852004 missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82852300 missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82855085 missense probably benign
R0732:Tcf20 UTSW 15 82852303 missense probably benign 0.07
R1502:Tcf20 UTSW 15 82855576 missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82855492 missense probably benign 0.19
R1719:Tcf20 UTSW 15 82852777 missense probably benign 0.03
R1997:Tcf20 UTSW 15 82857230 nonsense probably null
R2152:Tcf20 UTSW 15 82855602 missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82854692 missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82851685 missense probably benign
R4049:Tcf20 UTSW 15 82853429 missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82854984 missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82851727 missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82854199 missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82856603 missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82856185 missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82856381 missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82855955 missense probably benign 0.01
R5288:Tcf20 UTSW 15 82855709 missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82851957 missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82856199 missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82853242 missense probably benign 0.05
R5897:Tcf20 UTSW 15 82851783 nonsense probably null
R6089:Tcf20 UTSW 15 82853208 missense probably benign 0.06
R6196:Tcf20 UTSW 15 82851986 missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82854880 missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82852660 missense probably benign
R6688:Tcf20 UTSW 15 82854535 missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82854682 missense probably benign 0.07
R7051:Tcf20 UTSW 15 82856078 missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82853489 missense probably benign
R7486:Tcf20 UTSW 15 82853734 missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82855276 missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82851565 missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82856006 missense probably damaging 1.00
R8156:Tcf20 UTSW 15 82852937 missense probably benign 0.00
R8191:Tcf20 UTSW 15 82853405 nonsense probably null
R8259:Tcf20 UTSW 15 82852273 missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82852676 missense probably benign 0.04
R8447:Tcf20 UTSW 15 82853236 missense possibly damaging 0.77
R8497:Tcf20 UTSW 15 82855951 missense probably benign 0.07
R8728:Tcf20 UTSW 15 82854957 missense probably damaging 1.00
R8829:Tcf20 UTSW 15 82855714 missense probably damaging 1.00
R8861:Tcf20 UTSW 15 82852525 missense probably damaging 0.99
R9177:Tcf20 UTSW 15 82856504 missense probably benign 0.00
R9268:Tcf20 UTSW 15 82856504 missense probably benign 0.00
R9294:Tcf20 UTSW 15 82852696 missense probably benign 0.11
RF019:Tcf20 UTSW 15 82851593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGGTCAAGAAAGAACTTGTG -3'
(R):5'- TGCTCATCCTAGGTTCAAGCG -3'

Sequencing Primer
(F):5'- CTTGTGATGTGAAAGAACAAAGGCC -3'
(R):5'- ACCGCTCAGAAGACTGTGGTG -3'
Posted On 2018-06-12