Incidental Mutation 'R6166:Cnn2'
ID523284
Institutional Source Beutler Lab
Gene Symbol Cnn2
Ensembl Gene ENSMUSG00000004665
Gene Namecalponin 2
Synonymsh2-calponin, Calpo2
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R6166 (G1)
Quality Score70.0074
Status Validated
Chromosome10
Chromosomal Location79988584-79996062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79988727 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 17 (E17G)
Ref Sequence ENSEMBL: ENSMUSP00000004784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004784] [ENSMUST00000052885] [ENSMUST00000105374]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004784
AA Change: E17G

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004784
Gene: ENSMUSG00000004665
AA Change: E17G

DomainStartEndE-ValueType
CH 30 127 1.82e-22 SMART
Pfam:Calponin 166 190 6e-20 PFAM
Pfam:Calponin 206 230 6e-20 PFAM
Pfam:Calponin 245 268 2.6e-10 PFAM
low complexity region 276 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052885
SMART Domains Protein: ENSMUSP00000056792
Gene: ENSMUSG00000013858

DomainStartEndE-ValueType
Pfam:Membralin 34 131 3.3e-44 PFAM
Pfam:Membralin 138 393 3.9e-130 PFAM
transmembrane domain 394 411 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 483 521 N/A INTRINSIC
low complexity region 531 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105374
AA Change: E17G

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101013
Gene: ENSMUSG00000004665
AA Change: E17G

DomainStartEndE-ValueType
CH 30 127 1.82e-22 SMART
Pfam:Calponin 130 152 7.6e-15 PFAM
Pfam:Calponin 167 192 4.1e-16 PFAM
Pfam:Calponin 206 230 6.4e-15 PFAM
low complexity region 237 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124536
SMART Domains Protein: ENSMUSP00000119572
Gene: ENSMUSG00000013858

DomainStartEndE-ValueType
Pfam:Membralin 4 101 1.6e-44 PFAM
Pfam:Membralin 108 297 7.7e-83 PFAM
Pfam:Membralin 316 387 5e-42 PFAM
transmembrane domain 388 405 N/A INTRINSIC
low complexity region 449 464 N/A INTRINSIC
low complexity region 477 515 N/A INTRINSIC
low complexity region 525 538 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179260
Meta Mutation Damage Score 0.4890 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, which can bind actin, calmodulin, troponin C, and tropomyosin, may function in the structural organization of actin filaments. The encoded protein could play a role in smooth muscle contraction and cell adhesion. Several pseudogenes of this gene have been identified, and are present on chromosomes 1, 2, 3, 6, 9, 11, 13, 15, 16, 21 and 22. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for either a knock-out or a knock-down allele have reduced numbers of peripheral blood neutrophils and monocytes. Knock-out mice show increased macrophage proliferation, motility and phagocytosis, faster diapedesis of peripheral monocytesand neutrophils, and enhanced wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Camta2 G C 11: 70,674,261 probably null Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Cnn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Cnn2 APN 10 79992554 missense probably benign 0.01
IGL02715:Cnn2 APN 10 79993489 missense probably damaging 1.00
BB003:Cnn2 UTSW 10 79993326 missense probably damaging 1.00
BB013:Cnn2 UTSW 10 79993326 missense probably damaging 1.00
R1018:Cnn2 UTSW 10 79993563 missense probably damaging 0.97
R1294:Cnn2 UTSW 10 79993525 missense probably damaging 0.96
R1346:Cnn2 UTSW 10 79993580 unclassified probably benign
R2302:Cnn2 UTSW 10 79991399 missense possibly damaging 0.75
R3802:Cnn2 UTSW 10 79993495 missense probably benign 0.25
R4452:Cnn2 UTSW 10 79991442 missense probably benign
R7156:Cnn2 UTSW 10 79994515 nonsense probably null
R7465:Cnn2 UTSW 10 79992527 missense probably damaging 1.00
R7926:Cnn2 UTSW 10 79993326 missense probably damaging 1.00
R8395:Cnn2 UTSW 10 79992459 missense probably benign 0.08
X0025:Cnn2 UTSW 10 79992278 missense probably benign 0.06
X0064:Cnn2 UTSW 10 79994387 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATAAGGACATTTGCTCTGCCAG -3'
(R):5'- CTGGAGGTGACATTCAGGATG -3'

Sequencing Primer
(F):5'- GCTCTGCCAGCCAATCG -3'
(R):5'- TGCGGATAAAATGGGTCCCC -3'
Posted On2018-06-18