Incidental Mutation 'R6166:Camta2'
ID523285
Institutional Source Beutler Lab
Gene Symbol Camta2
Ensembl Gene ENSMUSG00000040712
Gene Namecalmodulin binding transcription activator 2
SynonymsKiaa0909-hp
MMRRC Submission 044312-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R6166 (G1)
Quality Score21.0411
Status Validated
Chromosome11
Chromosomal Location70669463-70688105 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to C at 70674261 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018431] [ENSMUST00000036299] [ENSMUST00000100933] [ENSMUST00000108544] [ENSMUST00000108545] [ENSMUST00000119120] [ENSMUST00000120261] [ENSMUST00000129434] [ENSMUST00000145823]
Predicted Effect probably benign
Transcript: ENSMUST00000018431
SMART Domains Protein: ENSMUSP00000018431
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 31 109 3.85e-21 SMART
low complexity region 130 152 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000036299
SMART Domains Protein: ENSMUSP00000043792
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 155 1.07e-83 SMART
low complexity region 232 243 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 370 380 N/A INTRINSIC
low complexity region 417 435 N/A INTRINSIC
low complexity region 461 485 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Pfam:TIG 541 621 6.2e-13 PFAM
low complexity region 660 679 N/A INTRINSIC
Blast:ANK 717 750 7e-12 BLAST
SCOP:d1myo__ 718 816 2e-15 SMART
Blast:ANK 762 792 4e-11 BLAST
low complexity region 829 839 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
IQ 1053 1075 2.59e2 SMART
IQ 1076 1092 2.38e2 SMART
IQ 1106 1128 5.42e0 SMART
low complexity region 1140 1157 N/A INTRINSIC
low complexity region 1180 1190 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100933
SMART Domains Protein: ENSMUSP00000098493
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 36 152 8.08e-88 SMART
low complexity region 229 240 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
low complexity region 414 432 N/A INTRINSIC
low complexity region 458 482 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
Pfam:TIG 538 618 1.2e-8 PFAM
low complexity region 657 676 N/A INTRINSIC
Blast:ANK 714 747 8e-12 BLAST
SCOP:d1myo__ 715 813 2e-15 SMART
Blast:ANK 759 789 4e-11 BLAST
low complexity region 826 836 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 858 879 N/A INTRINSIC
IQ 1050 1072 2.59e2 SMART
IQ 1073 1095 1.18e1 SMART
IQ 1096 1118 5.42e0 SMART
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1170 1180 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108544
SMART Domains Protein: ENSMUSP00000104184
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.2e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 4e-11 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1087 2.38e2 SMART
IQ 1101 1123 5.42e0 SMART
low complexity region 1135 1152 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108545
SMART Domains Protein: ENSMUSP00000104185
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1.1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 5e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1069 1.18e1 SMART
IQ 1070 1092 5.42e0 SMART
low complexity region 1104 1121 N/A INTRINSIC
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119120
SMART Domains Protein: ENSMUSP00000113847
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.1e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 8e-13 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1093 1.18e1 SMART
IQ 1094 1116 5.42e0 SMART
low complexity region 1128 1145 N/A INTRINSIC
low complexity region 1168 1178 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120261
SMART Domains Protein: ENSMUSP00000113667
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 7e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1063 2.38e2 SMART
IQ 1077 1099 5.42e0 SMART
low complexity region 1111 1128 N/A INTRINSIC
low complexity region 1151 1161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125687
Predicted Effect probably benign
Transcript: ENSMUST00000129434
SMART Domains Protein: ENSMUSP00000115098
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 22 99 3.06e-15 SMART
low complexity region 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145823
SMART Domains Protein: ENSMUSP00000123602
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 137 2.55e-44 SMART
low complexity region 146 165 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the calmodulin-binding transcription activator protein family. Members of this family share a common domain structure that consists of a transcription activation domain, a DNA-binding domain, and a calmodulin-binding domain. The encoded protein may be a transcriptional coactivator of genes involved in cardiac growth. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and free of obvious cardiac defects, but show reduced pathophysiologic cardiac hypertrophy in response to diverse stress stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,560 H478R probably benign Het
Acot2 A T 12: 83,992,604 N296Y probably damaging Het
Ago2 T A 15: 73,124,240 I347L probably benign Het
Aldh1l2 C T 10: 83,493,424 probably null Het
Ap1ar A G 3: 127,812,528 probably null Het
Arap3 T C 18: 37,974,370 T1365A probably damaging Het
Arhgef17 A T 7: 100,876,492 H1966Q probably damaging Het
Arpp21 T C 9: 112,119,198 T668A probably benign Het
Atg13 G T 2: 91,676,391 Q479K probably damaging Het
BC049730 A T 7: 24,714,219 Q220L probably benign Het
Bmp8a T C 4: 123,324,678 T183A probably benign Het
Ccdc40 T C 11: 119,232,001 S210P probably benign Het
Cnn2 A G 10: 79,988,727 E17G possibly damaging Het
Cnot6l T C 5: 96,079,940 D478G possibly damaging Het
Csf2rb A G 15: 78,344,566 Y369C probably damaging Het
Dll4 A G 2: 119,334,626 probably null Het
Efcab6 A G 15: 83,896,115 V1039A probably benign Het
Fam117a T C 11: 95,380,781 M393T possibly damaging Het
Fancd2 T A 6: 113,555,251 N508K possibly damaging Het
Fat1 T C 8: 44,952,485 S758P probably damaging Het
Fgf20 T C 8: 40,279,840 K186E probably damaging Het
Filip1 T C 9: 79,819,454 K628E probably damaging Het
Fsip2 G T 2: 82,980,727 K2463N probably benign Het
Gm15446 T A 5: 109,942,780 Y299* probably null Het
Gm16432 A G 1: 178,103,837 T441A unknown Het
Gm7363 A T 7: 3,983,785 noncoding transcript Het
Gpx5 A T 13: 21,289,265 F104I probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
Hmcn2 G A 2: 31,369,262 G1038D probably damaging Het
Lgals9 C T 11: 78,971,358 A134T probably benign Het
Lrba G A 3: 86,354,307 probably null Het
Naprt T C 15: 75,891,477 Q439R possibly damaging Het
Ndufs6 G A 13: 73,317,941 probably benign Het
Nodal C A 10: 61,424,558 S329R probably damaging Het
Olfm3 T A 3: 115,122,425 N315K probably damaging Het
Olfr420 A G 1: 174,159,093 T107A probably benign Het
Olfr730 C T 14: 50,186,768 V150I probably benign Het
Olfr803 A T 10: 129,691,279 I254K probably damaging Het
Plg T A 17: 12,398,114 V373E probably damaging Het
Prdm2 A C 4: 143,134,736 S661R probably damaging Het
Psg21 A T 7: 18,656,739 probably benign Het
Rhobtb2 T C 14: 69,798,178 D148G probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scaf11 A T 15: 96,424,662 N116K probably damaging Het
Sf3a3 T C 4: 124,723,384 probably benign Homo
Slc38a9 T G 13: 112,695,267 Y184D possibly damaging Het
Sowahc A G 10: 59,222,360 D106G probably benign Het
Srbd1 T C 17: 86,099,268 Y563C probably damaging Het
Src A G 2: 157,468,522 Y359C probably damaging Het
Tbc1d9b A G 11: 50,135,846 D47G probably damaging Het
Tctn3 T C 19: 40,597,479 K541E possibly damaging Het
Tgm7 A G 2: 121,099,058 V245A probably damaging Het
Thbs2 C T 17: 14,680,388 R519H probably damaging Het
Tm4sf19 T C 16: 32,407,863 S157P probably damaging Het
Trio C T 15: 27,818,071 S507N probably damaging Het
Trrap T A 5: 144,781,981 H152Q possibly damaging Het
Vmn2r56 A G 7: 12,694,020 L773P probably damaging Het
Vmn2r70 A G 7: 85,565,981 L115P probably benign Het
Wdr59 C T 8: 111,472,661 R631H probably damaging Het
Other mutations in Camta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Camta2 APN 11 70671482 nonsense probably null
IGL01472:Camta2 APN 11 70684124 missense probably damaging 1.00
IGL02548:Camta2 APN 11 70670685 missense probably damaging 1.00
IGL02794:Camta2 APN 11 70675658 missense possibly damaging 0.94
IGL02983:Camta2 APN 11 70672022 missense probably damaging 0.99
IGL03035:Camta2 APN 11 70671509 nonsense probably null
weeping UTSW 11 70683308 missense probably damaging 1.00
Willow UTSW 11 70678325 missense probably damaging 1.00
P0027:Camta2 UTSW 11 70684005 missense probably damaging 1.00
R0360:Camta2 UTSW 11 70683310 missense probably damaging 1.00
R0364:Camta2 UTSW 11 70683310 missense probably damaging 1.00
R0541:Camta2 UTSW 11 70681621 missense probably benign 0.01
R0600:Camta2 UTSW 11 70673959 missense possibly damaging 0.94
R0630:Camta2 UTSW 11 70678305 missense probably damaging 1.00
R1301:Camta2 UTSW 11 70676404 missense probably benign 0.18
R1346:Camta2 UTSW 11 70676467 missense possibly damaging 0.89
R1826:Camta2 UTSW 11 70683308 missense probably damaging 1.00
R1881:Camta2 UTSW 11 70672016 missense probably benign 0.00
R1980:Camta2 UTSW 11 70682482 missense probably benign 0.43
R2144:Camta2 UTSW 11 70671575 missense probably benign 0.31
R2145:Camta2 UTSW 11 70671575 missense probably benign 0.31
R2763:Camta2 UTSW 11 70682530 nonsense probably null
R2881:Camta2 UTSW 11 70679664 splice site probably null
R2917:Camta2 UTSW 11 70680961 missense probably damaging 1.00
R4115:Camta2 UTSW 11 70676474 missense possibly damaging 0.93
R4321:Camta2 UTSW 11 70678325 missense probably damaging 1.00
R4470:Camta2 UTSW 11 70680940 missense probably damaging 1.00
R4499:Camta2 UTSW 11 70674686 missense probably damaging 1.00
R4509:Camta2 UTSW 11 70681018 missense probably benign 0.28
R6154:Camta2 UTSW 11 70678385 missense probably damaging 1.00
R6287:Camta2 UTSW 11 70681469 missense probably damaging 0.98
R6382:Camta2 UTSW 11 70672041 missense probably damaging 0.99
R6864:Camta2 UTSW 11 70671966 missense probably benign 0.00
R6922:Camta2 UTSW 11 70674138 missense probably benign 0.04
R7438:Camta2 UTSW 11 70683888 critical splice donor site probably null
R7611:Camta2 UTSW 11 70681546 missense possibly damaging 0.85
R7883:Camta2 UTSW 11 70675211 missense probably damaging 1.00
R8094:Camta2 UTSW 11 70686077 missense probably damaging 1.00
R8232:Camta2 UTSW 11 70683015 missense unknown
R8271:Camta2 UTSW 11 70671060 missense probably benign 0.05
T0722:Camta2 UTSW 11 70684005 missense probably damaging 1.00
X0066:Camta2 UTSW 11 70681678 missense probably benign 0.08
Z1177:Camta2 UTSW 11 70675221 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTTCATAGTCCATGAGGAG -3'
(R):5'- ACTGGTGAGAGCTGGCATTG -3'

Sequencing Primer
(F):5'- CCATGAGGAGTAAGGGTGTCTC -3'
(R):5'- AGAGACTGGCTGTGCTTCC -3'
Posted On2018-06-18