Incidental Mutation 'R6215:Gm10719'
ID523286
Institutional Source Beutler Lab
Gene Symbol Gm10719
Ensembl Gene ENSMUSG00000095547
Gene Namepredicted gene 10719
Synonyms
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R6215 (G1)
Quality Score66.1326
Status Validated
Chromosome9
Chromosomal Location3017408-3021593 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 3019040 bp
ZygosityHomozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099046] [ENSMUST00000099047] [ENSMUST00000099049] [ENSMUST00000099050] [ENSMUST00000143083] [ENSMUST00000179272]
Predicted Effect probably null
Transcript: ENSMUST00000099046
SMART Domains Protein: ENSMUSP00000096645
Gene: ENSMUSG00000095186

DomainStartEndE-ValueType
internal_repeat_1 1 41 4.44e-7 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 177 4.44e-7 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099047
SMART Domains Protein: ENSMUSP00000096646
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 40 1.58e-10 PROSPERO
transmembrane domain 53 72 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 176 1.58e-10 PROSPERO
transmembrane domain 199 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099049
SMART Domains Protein: ENSMUSP00000096648
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 46 2.19e-9 PROSPERO
transmembrane domain 62 84 N/A INTRINSIC
internal_repeat_1 117 182 2.19e-9 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099050
SMART Domains Protein: ENSMUSP00000096649
Gene: ENSMUSG00000074564

DomainStartEndE-ValueType
internal_repeat_1 1 46 7.44e-11 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 182 7.44e-11 PROSPERO
transmembrane domain 192 214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143083
SMART Domains Protein: ENSMUSP00000137330
Gene: ENSMUSG00000096519

DomainStartEndE-ValueType
internal_repeat_1 1 19 1.27e-7 PROSPERO
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 135 1.27e-7 PROSPERO
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179272
AA Change: L95Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136170
Gene: ENSMUSG00000095547
AA Change: L95Q

DomainStartEndE-ValueType
internal_repeat_1 1 49 2.1e-10 PROSPERO
transmembrane domain 74 96 N/A INTRINSIC
internal_repeat_1 118 186 2.1e-10 PROSPERO
transmembrane domain 198 217 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181572
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Gm10719
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4063:Gm10719 UTSW 9 3019043 missense probably damaging 1.00
R4559:Gm10719 UTSW 9 3018945 missense probably benign 0.17
R4952:Gm10719 UTSW 9 3018962 missense probably benign
R5042:Gm10719 UTSW 9 3018970 missense probably damaging 1.00
R5521:Gm10719 UTSW 9 3018970 missense probably damaging 1.00
R5538:Gm10719 UTSW 9 3018962 missense probably benign
V5622:Gm10719 UTSW 9 3021253 unclassified probably null
Predicted Primers PCR Primer
(F):5'- GTCCTACAGTGTGCATTTCTCA -3'
(R):5'- ACATCCACTTGACGACGTGAAA -3'

Sequencing Primer
(F):5'- CGCCATATTTCACGTGCTAAAGTG -3'
(R):5'- TGAGAAATGCACCCTGTATGACCTG -3'
Posted On2018-06-18