Incidental Mutation 'R6573:Edf1'
ID523299
Institutional Source Beutler Lab
Gene Symbol Edf1
Ensembl Gene ENSMUSG00000015092
Gene Nameendothelial differentiation-related factor 1
Synonyms0610008L11Rik, hypothetical protein 1-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R6573 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25557847-25562082 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25561863 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 133 (R133L)
Ref Sequence ENSEMBL: ENSMUSP00000015236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015236] [ENSMUST00000095117] [ENSMUST00000114223]
Predicted Effect probably damaging
Transcript: ENSMUST00000015236
AA Change: R133L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015236
Gene: ENSMUSG00000015092
AA Change: R133L

DomainStartEndE-ValueType
Pfam:MBF1 4 73 4.6e-29 PFAM
HTH_XRE 80 135 1.02e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095117
SMART Domains Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 58 7.33e-1 SMART
MAM 66 227 3.56e-52 SMART
LDLa 233 272 3.5e-9 SMART
MAM 254 430 3.87e-53 SMART
LDLa 461 497 2.63e-4 SMART
MAM 493 653 5.33e-5 SMART
MAM 660 819 3.68e-68 SMART
MAM 820 979 1.07e-28 SMART
MAM 980 1148 2.07e-62 SMART
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114223
SMART Domains Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 28 54 7.33e-1 SMART
MAM 62 223 3.56e-52 SMART
LDLa 229 268 3.5e-9 SMART
MAM 250 426 3.87e-53 SMART
LDLa 457 493 2.63e-4 SMART
MAM 489 649 5.33e-5 SMART
MAM 656 815 3.68e-68 SMART
MAM 816 975 1.07e-28 SMART
MAM 976 1144 2.07e-62 SMART
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144395
Predicted Effect probably benign
Transcript: ENSMUST00000152237
SMART Domains Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941

DomainStartEndE-ValueType
LDLa 9 35 7.33e-1 SMART
MAM 43 204 3.56e-52 SMART
LDLa 210 249 3.5e-9 SMART
MAM 231 407 3.87e-53 SMART
LDLa 438 474 2.63e-4 SMART
MAM 558 717 2.27e-68 SMART
MAM 718 877 1.07e-28 SMART
MAM 878 1046 2.07e-62 SMART
transmembrane domain 1063 1085 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153008
Meta Mutation Damage Score 0.8682 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may regulate endothelial cell differentiation, lipid metabolism, and hormone-induced cardiomyocyte hypertrophy. The encoded protein has also been found to act as a transcriptional coactivator by interconnecting the general transcription factor TATA element-binding protein (TBP) and gene-specific activators. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cr12 A G 1: 58,666,844 F289L probably benign Het
Ceacam5 A G 7: 17,713,447 M1V probably null Het
Clstn1 A G 4: 149,643,689 T605A probably damaging Het
Cstf2t A G 19: 31,083,780 M239V probably benign Het
Dsp A T 13: 38,196,862 R1929W probably damaging Het
Efcab3 A T 11: 105,080,635 Y129F possibly damaging Het
Fam189a2 T A 19: 23,988,502 N211I probably damaging Het
Fbxo34 A T 14: 47,529,667 L212F possibly damaging Het
Gas2l3 C A 10: 89,422,210 probably null Het
Gfod1 C T 13: 43,200,365 S378N probably damaging Het
Gse1 T C 8: 120,567,797 S288P probably damaging Het
Gzme T A 14: 56,118,826 T72S probably benign Het
Hyal5 T C 6: 24,891,552 V455A probably damaging Het
Megf9 A T 4: 70,488,172 C252* probably null Het
Mrgprg T C 7: 143,764,596 K260E possibly damaging Het
Nmi T A 2: 51,950,069 K220M possibly damaging Het
Nutm1 A C 2: 112,251,043 probably null Het
Olfr1008 C T 2: 85,689,999 S190L probably damaging Het
Olfr694 A T 7: 106,689,463 D89E probably benign Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Perm1 C A 4: 156,218,673 A558D probably damaging Het
Pgpep1 A G 8: 70,650,615 I203T probably benign Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Prune2 G T 19: 17,121,157 G1342C probably damaging Het
Prune2 G T 19: 17,121,158 G1342V possibly damaging Het
Ros1 T A 10: 52,155,010 I512F possibly damaging Het
Slc10a5 A T 3: 10,335,050 F183L probably damaging Het
Slc13a1 T C 6: 24,137,095 R107G probably damaging Het
Spag5 C T 11: 78,314,182 Q598* probably null Het
Spata6 T A 4: 111,779,279 F256I probably damaging Het
Tnnt1 C A 7: 4,514,334 probably null Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Unc79 G A 12: 103,061,388 E413K probably damaging Het
Vmn2r104 A T 17: 20,042,225 F214L probably damaging Het
Vmn2r118 C T 17: 55,592,996 C636Y probably damaging Het
Zfat T C 15: 68,165,854 N917S probably damaging Het
Zfp317 T C 9: 19,645,254 S53P probably damaging Het
Other mutations in Edf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1803:Edf1 UTSW 2 25560194 missense probably damaging 0.97
R2157:Edf1 UTSW 2 25558031 critical splice donor site probably null
R8314:Edf1 UTSW 2 25557965 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGACCCACACTCTGAGGTC -3'
(R):5'- CCAGGAGGCTATCACTTTACAAG -3'

Sequencing Primer
(F):5'- TCAGATGTGAAAGCAGCCTTGTG -3'
(R):5'- GAGGCTATCACTTTACAAGGTTTGC -3'
Posted On2018-06-22