Mutagenetix > Incidental Mutations

Incidental Mutation 'R6573:Edf1'

523299

Institutional Source

Beutler Lab

Gene Symbol

Edf1

Ensembl Gene

ENSMUSG00000015092

Gene Name

endothelial differentiation-related factor 1

Synonyms

0610008L11Rik, hypothetical protein 1-9

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.791) question?

Stock #

R6573 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25557847-25562082 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 25561863 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 133 (R133L)

Ref Sequence

ENSEMBL: ENSMUSP00000015236 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015236] [ENSMUST00000095117] [ENSMUST00000114223]

AlphaFold

Q9JMG1

Predicted Effect

probably damaging
Transcript: ENSMUST00000015236
AA Change: R133L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000015236
Gene: ENSMUSG00000015092
AA Change: R133L

Domain	Start	End	E-Value	Type
Pfam:MBF1	4	73	4.6e-29	PFAM
HTH_XRE	80	135	1.02e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000095117

SMART Domains

Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
LDLa	32	58	7.33e-1	SMART
MAM	66	227	3.56e-52	SMART
LDLa	233	272	3.5e-9	SMART
MAM	254	430	3.87e-53	SMART
LDLa	461	497	2.63e-4	SMART
MAM	493	653	5.33e-5	SMART
MAM	660	819	3.68e-68	SMART
MAM	820	979	1.07e-28	SMART
MAM	980	1148	2.07e-62	SMART
transmembrane domain	1165	1187	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114223

SMART Domains

Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
LDLa	28	54	7.33e-1	SMART
MAM	62	223	3.56e-52	SMART
LDLa	229	268	3.5e-9	SMART
MAM	250	426	3.87e-53	SMART
LDLa	457	493	2.63e-4	SMART
MAM	489	649	5.33e-5	SMART
MAM	656	815	3.68e-68	SMART
MAM	816	975	1.07e-28	SMART
MAM	976	1144	2.07e-62	SMART
transmembrane domain	1161	1183	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134689

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142288

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144395

Predicted Effect

probably benign
Transcript: ENSMUST00000152237

SMART Domains

Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941

Domain	Start	End	E-Value	Type
LDLa	9	35	7.33e-1	SMART
MAM	43	204	3.56e-52	SMART
LDLa	210	249	3.5e-9	SMART
MAM	231	407	3.87e-53	SMART
LDLa	438	474	2.63e-4	SMART
MAM	558	717	2.27e-68	SMART
MAM	718	877	1.07e-28	SMART
MAM	878	1046	2.07e-62	SMART
transmembrane domain	1063	1085	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153008

Meta Mutation Damage Score

0.8682

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may regulate endothelial cell differentiation, lipid metabolism, and hormone-induced cardiomyocyte hypertrophy. The encoded protein has also been found to act as a transcriptional coactivator by interconnecting the general transcription factor TATA element-binding protein (TBP) and gene-specific activators. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Als2cr12	A	G	1: 58,666,844	F289L	probably benign	Het
Ceacam5	A	G	7: 17,713,447	M1V	probably null	Het
Clstn1	A	G	4: 149,643,689	T605A	probably damaging	Het
Cstf2t	A	G	19: 31,083,780	M239V	probably benign	Het
Dsp	A	T	13: 38,196,862	R1929W	probably damaging	Het
Efcab3	A	T	11: 105,080,635	Y129F	possibly damaging	Het
Fam189a2	T	A	19: 23,988,502	N211I	probably damaging	Het
Fbxo34	A	T	14: 47,529,667	L212F	possibly damaging	Het
Gas2l3	C	A	10: 89,422,210		probably null	Het
Gfod1	C	T	13: 43,200,365	S378N	probably damaging	Het
Gse1	T	C	8: 120,567,797	S288P	probably damaging	Het
Gzme	T	A	14: 56,118,826	T72S	probably benign	Het
Hyal5	T	C	6: 24,891,552	V455A	probably damaging	Het
Megf9	A	T	4: 70,488,172	C252*	probably null	Het
Mrgprg	T	C	7: 143,764,596	K260E	possibly damaging	Het
Nmi	T	A	2: 51,950,069	K220M	possibly damaging	Het
Nutm1	A	C	2: 112,251,043		probably null	Het
Olfr1008	C	T	2: 85,689,999	S190L	probably damaging	Het
Olfr694	A	T	7: 106,689,463	D89E	probably benign	Het
Pde4b	T	A	4: 102,430,162	I34N	probably damaging	Het
Perm1	C	A	4: 156,218,673	A558D	probably damaging	Het
Pgpep1	A	G	8: 70,650,615	I203T	probably benign	Het
Pmp22	C	T	11: 63,158,273	A114V	probably damaging	Het
Prune2	G	T	19: 17,121,157	G1342C	probably damaging	Het
Prune2	G	T	19: 17,121,158	G1342V	possibly damaging	Het
Ros1	T	A	10: 52,155,010	I512F	possibly damaging	Het
Slc10a5	A	T	3: 10,335,050	F183L	probably damaging	Het
Slc13a1	T	C	6: 24,137,095	R107G	probably damaging	Het
Spag5	C	T	11: 78,314,182	Q598*	probably null	Het
Spata6	T	A	4: 111,779,279	F256I	probably damaging	Het
Tnnt1	C	A	7: 4,514,334		probably null	Het
Top2b	T	A	14: 16,398,991	L537Q	probably damaging	Het
Unc79	G	A	12: 103,061,388	E413K	probably damaging	Het
Vmn2r104	A	T	17: 20,042,225	F214L	probably damaging	Het
Vmn2r118	C	T	17: 55,592,996	C636Y	probably damaging	Het
Zfat	T	C	15: 68,165,854	N917S	probably damaging	Het
Zfp317	T	C	9: 19,645,254	S53P	probably damaging	Het

Other mutations in Edf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1803:Edf1	UTSW	2	25560194	missense	probably damaging	0.97
R2157:Edf1	UTSW	2	25558031	critical splice donor site	probably null
R8314:Edf1	UTSW	2	25557965	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTGACCCACACTCTGAGGTC -3'
(R):5'- CCAGGAGGCTATCACTTTACAAG -3'

Sequencing Primer
(F):5'- TCAGATGTGAAAGCAGCCTTGTG -3'
(R):5'- GAGGCTATCACTTTACAAGGTTTGC -3'

Posted On

2018-06-22