Incidental Mutation 'R6573:Olfr694'
ID523312
Institutional Source Beutler Lab
Gene Symbol Olfr694
Ensembl Gene ENSMUSG00000064223
Gene Nameolfactory receptor 694
SynonymsMOR283-9, GA_x6K02T2PBJ9-9067220-9066273
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6573 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106684980-106691814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106689463 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 89 (D89E)
Ref Sequence ENSEMBL: ENSMUSP00000151027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052535] [ENSMUST00000082091] [ENSMUST00000216118] [ENSMUST00000216895]
Predicted Effect probably benign
Transcript: ENSMUST00000052535
AA Change: D89E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057180
Gene: ENSMUSG00000064223
AA Change: D89E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.1e-43 PFAM
Pfam:7tm_1 41 290 9.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082091
AA Change: D89E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080740
Gene: ENSMUSG00000064223
AA Change: D89E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.6e-6 PFAM
Pfam:7tm_1 41 290 7.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208331
Predicted Effect probably benign
Transcript: ENSMUST00000216118
AA Change: D89E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216895
AA Change: D89E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cr12 A G 1: 58,666,844 F289L probably benign Het
Ceacam5 A G 7: 17,713,447 M1V probably null Het
Clstn1 A G 4: 149,643,689 T605A probably damaging Het
Cstf2t A G 19: 31,083,780 M239V probably benign Het
Dsp A T 13: 38,196,862 R1929W probably damaging Het
Edf1 G T 2: 25,561,863 R133L probably damaging Het
Efcab3 A T 11: 105,080,635 Y129F possibly damaging Het
Fam189a2 T A 19: 23,988,502 N211I probably damaging Het
Fbxo34 A T 14: 47,529,667 L212F possibly damaging Het
Gas2l3 C A 10: 89,422,210 probably null Het
Gfod1 C T 13: 43,200,365 S378N probably damaging Het
Gse1 T C 8: 120,567,797 S288P probably damaging Het
Gzme T A 14: 56,118,826 T72S probably benign Het
Hyal5 T C 6: 24,891,552 V455A probably damaging Het
Megf9 A T 4: 70,488,172 C252* probably null Het
Mrgprg T C 7: 143,764,596 K260E possibly damaging Het
Nmi T A 2: 51,950,069 K220M possibly damaging Het
Nutm1 A C 2: 112,251,043 probably null Het
Olfr1008 C T 2: 85,689,999 S190L probably damaging Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Perm1 C A 4: 156,218,673 A558D probably damaging Het
Pgpep1 A G 8: 70,650,615 I203T probably benign Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Prune2 G T 19: 17,121,157 G1342C probably damaging Het
Prune2 G T 19: 17,121,158 G1342V possibly damaging Het
Ros1 T A 10: 52,155,010 I512F possibly damaging Het
Slc10a5 A T 3: 10,335,050 F183L probably damaging Het
Slc13a1 T C 6: 24,137,095 R107G probably damaging Het
Spag5 C T 11: 78,314,182 Q598* probably null Het
Spata6 T A 4: 111,779,279 F256I probably damaging Het
Tnnt1 C A 7: 4,514,334 probably null Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Unc79 G A 12: 103,061,388 E413K probably damaging Het
Vmn2r104 A T 17: 20,042,225 F214L probably damaging Het
Vmn2r118 C T 17: 55,592,996 C636Y probably damaging Het
Zfat T C 15: 68,165,854 N917S probably damaging Het
Zfp317 T C 9: 19,645,254 S53P probably damaging Het
Other mutations in Olfr694
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr694 APN 7 106689531 missense probably damaging 1.00
IGL01759:Olfr694 APN 7 106689333 missense probably benign 0.04
IGL02435:Olfr694 APN 7 106689503 missense probably benign 0.26
IGL02569:Olfr694 APN 7 106689642 missense probably benign 0.19
IGL02611:Olfr694 APN 7 106688789 missense probably benign 0.11
IGL02726:Olfr694 APN 7 106689370 nonsense probably null
IGL02944:Olfr694 APN 7 106689269 missense probably damaging 1.00
IGL03155:Olfr694 APN 7 106689239 missense probably damaging 1.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0609:Olfr694 UTSW 7 106688998 missense probably damaging 1.00
R0655:Olfr694 UTSW 7 106689425 missense probably damaging 1.00
R1562:Olfr694 UTSW 7 106688980 missense probably benign 0.01
R1641:Olfr694 UTSW 7 106689711 missense probably benign 0.36
R2144:Olfr694 UTSW 7 106688957 missense probably damaging 0.99
R4416:Olfr694 UTSW 7 106689011 missense probably benign 0.07
R4444:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4445:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4567:Olfr694 UTSW 7 106689213 nonsense probably null
R4739:Olfr694 UTSW 7 106689144 nonsense probably null
R4778:Olfr694 UTSW 7 106689667 missense probably damaging 0.97
R4908:Olfr694 UTSW 7 106689533 missense probably damaging 1.00
R5244:Olfr694 UTSW 7 106689189 missense probably benign 0.12
R5944:Olfr694 UTSW 7 106689646 nonsense probably null
R6260:Olfr694 UTSW 7 106688872 missense probably damaging 1.00
R6901:Olfr694 UTSW 7 106689189 missense probably benign 0.03
R7230:Olfr694 UTSW 7 106689524 missense possibly damaging 0.94
R7420:Olfr694 UTSW 7 106689020 missense possibly damaging 0.74
R7426:Olfr694 UTSW 7 106689210 missense possibly damaging 0.88
U24488:Olfr694 UTSW 7 106689089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTAGAGCACTGAGAGATGC -3'
(R):5'- AGCTGCTCTGTGCCACTATC -3'

Sequencing Primer
(F):5'- CACTGAGAGATGCAAGGATCC -3'
(R):5'- GTGCCACTATCACAGCCCTG -3'
Posted On2018-06-22