Incidental Mutation 'R6573:Fbxo34'
ID523325
Institutional Source Beutler Lab
Gene Symbol Fbxo34
Ensembl Gene ENSMUSG00000037536
Gene NameF-box protein 34
Synonyms5830426G16Rik, 2900057B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6573 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location47450421-47531962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47529667 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 212 (L212F)
Ref Sequence ENSEMBL: ENSMUSP00000044675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043112] [ENSMUST00000095941] [ENSMUST00000163324] [ENSMUST00000165714] [ENSMUST00000168833] [ENSMUST00000226395] [ENSMUST00000226432] [ENSMUST00000226954] [ENSMUST00000228019] [ENSMUST00000228668] [ENSMUST00000228740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043112
AA Change: L212F

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044675
Gene: ENSMUSG00000037536
AA Change: L212F

DomainStartEndE-ValueType
low complexity region 8 45 N/A INTRINSIC
FBOX 613 653 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095941
AA Change: L161F

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093634
Gene: ENSMUSG00000037536
AA Change: L161F

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163324
AA Change: L161F

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131708
Gene: ENSMUSG00000037536
AA Change: L161F

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165714
AA Change: L161F

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130036
Gene: ENSMUSG00000037536
AA Change: L161F

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168833
AA Change: L161F

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132271
Gene: ENSMUSG00000037536
AA Change: L161F

DomainStartEndE-ValueType
FBOX 562 602 1.84e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226395
Predicted Effect probably benign
Transcript: ENSMUST00000226432
Predicted Effect probably benign
Transcript: ENSMUST00000226954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227162
Predicted Effect probably benign
Transcript: ENSMUST00000227601
Predicted Effect probably benign
Transcript: ENSMUST00000228019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228634
Predicted Effect probably benign
Transcript: ENSMUST00000228668
Predicted Effect probably benign
Transcript: ENSMUST00000228740
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO34, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cr12 A G 1: 58,666,844 F289L probably benign Het
Ceacam5 A G 7: 17,713,447 M1V probably null Het
Clstn1 A G 4: 149,643,689 T605A probably damaging Het
Cstf2t A G 19: 31,083,780 M239V probably benign Het
Dsp A T 13: 38,196,862 R1929W probably damaging Het
Edf1 G T 2: 25,561,863 R133L probably damaging Het
Efcab3 A T 11: 105,080,635 Y129F possibly damaging Het
Fam189a2 T A 19: 23,988,502 N211I probably damaging Het
Gas2l3 C A 10: 89,422,210 probably null Het
Gfod1 C T 13: 43,200,365 S378N probably damaging Het
Gse1 T C 8: 120,567,797 S288P probably damaging Het
Gzme T A 14: 56,118,826 T72S probably benign Het
Hyal5 T C 6: 24,891,552 V455A probably damaging Het
Megf9 A T 4: 70,488,172 C252* probably null Het
Mrgprg T C 7: 143,764,596 K260E possibly damaging Het
Nmi T A 2: 51,950,069 K220M possibly damaging Het
Nutm1 A C 2: 112,251,043 probably null Het
Olfr1008 C T 2: 85,689,999 S190L probably damaging Het
Olfr694 A T 7: 106,689,463 D89E probably benign Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Perm1 C A 4: 156,218,673 A558D probably damaging Het
Pgpep1 A G 8: 70,650,615 I203T probably benign Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Prune2 G T 19: 17,121,157 G1342C probably damaging Het
Prune2 G T 19: 17,121,158 G1342V possibly damaging Het
Ros1 T A 10: 52,155,010 I512F possibly damaging Het
Slc10a5 A T 3: 10,335,050 F183L probably damaging Het
Slc13a1 T C 6: 24,137,095 R107G probably damaging Het
Spag5 C T 11: 78,314,182 Q598* probably null Het
Spata6 T A 4: 111,779,279 F256I probably damaging Het
Tnnt1 C A 7: 4,514,334 probably null Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Unc79 G A 12: 103,061,388 E413K probably damaging Het
Vmn2r104 A T 17: 20,042,225 F214L probably damaging Het
Vmn2r118 C T 17: 55,592,996 C636Y probably damaging Het
Zfat T C 15: 68,165,854 N917S probably damaging Het
Zfp317 T C 9: 19,645,254 S53P probably damaging Het
Other mutations in Fbxo34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Fbxo34 APN 14 47529474 missense probably damaging 0.97
IGL01337:Fbxo34 APN 14 47530217 missense probably benign 0.05
IGL01418:Fbxo34 APN 14 47530784 missense possibly damaging 0.46
IGL02069:Fbxo34 APN 14 47529613 missense probably damaging 1.00
IGL02829:Fbxo34 APN 14 47529689 missense probably benign 0.00
R0601:Fbxo34 UTSW 14 47530257 missense probably benign
R0714:Fbxo34 UTSW 14 47530029 missense probably damaging 1.00
R1186:Fbxo34 UTSW 14 47530586 missense probably damaging 0.99
R1714:Fbxo34 UTSW 14 47529201 missense probably damaging 1.00
R1842:Fbxo34 UTSW 14 47531007 missense probably damaging 0.98
R2127:Fbxo34 UTSW 14 47530106 missense probably damaging 0.98
R4199:Fbxo34 UTSW 14 47530997 missense probably damaging 1.00
R4649:Fbxo34 UTSW 14 47529628 missense probably damaging 1.00
R4801:Fbxo34 UTSW 14 47530869 missense probably damaging 1.00
R4802:Fbxo34 UTSW 14 47530869 missense probably damaging 1.00
R4906:Fbxo34 UTSW 14 47529454 missense probably benign 0.26
R5475:Fbxo34 UTSW 14 47529345 missense probably benign 0.01
R5888:Fbxo34 UTSW 14 47529719 missense probably damaging 0.98
R7236:Fbxo34 UTSW 14 47530384 missense probably benign 0.00
R7257:Fbxo34 UTSW 14 47500872 critical splice donor site probably null
R7381:Fbxo34 UTSW 14 47530535 missense probably benign 0.02
R7515:Fbxo34 UTSW 14 47530341 missense possibly damaging 0.84
R7562:Fbxo34 UTSW 14 47529678 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACCTGGGCTATTGTCAAAC -3'
(R):5'- GAAATCTTCACAATGGCAGGC -3'

Sequencing Primer
(F):5'- GCTATTGTCAAACCTGGGAAC -3'
(R):5'- CTTCACAATGGCAGGCGAATTTG -3'
Posted On2018-06-22