Incidental Mutation 'R6573:Vmn2r118'
ID 523329
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Name vomeronasal 2, receptor 118
Synonyms EG383258, Vmn2r119, EG668547
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R6573 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 55592341-55624672 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 55592996 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 636 (C636Y)
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
AlphaFold E9Q1C1
Predicted Effect probably damaging
Transcript: ENSMUST00000168440
AA Change: C636Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: C636Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cr12 A G 1: 58,666,844 F289L probably benign Het
Ceacam5 A G 7: 17,713,447 M1V probably null Het
Clstn1 A G 4: 149,643,689 T605A probably damaging Het
Cstf2t A G 19: 31,083,780 M239V probably benign Het
Dsp A T 13: 38,196,862 R1929W probably damaging Het
Edf1 G T 2: 25,561,863 R133L probably damaging Het
Efcab3 A T 11: 105,080,635 Y129F possibly damaging Het
Fam189a2 T A 19: 23,988,502 N211I probably damaging Het
Fbxo34 A T 14: 47,529,667 L212F possibly damaging Het
Gas2l3 C A 10: 89,422,210 probably null Het
Gfod1 C T 13: 43,200,365 S378N probably damaging Het
Gse1 T C 8: 120,567,797 S288P probably damaging Het
Gzme T A 14: 56,118,826 T72S probably benign Het
Hyal5 T C 6: 24,891,552 V455A probably damaging Het
Megf9 A T 4: 70,488,172 C252* probably null Het
Mrgprg T C 7: 143,764,596 K260E possibly damaging Het
Nmi T A 2: 51,950,069 K220M possibly damaging Het
Nutm1 A C 2: 112,251,043 probably null Het
Olfr1008 C T 2: 85,689,999 S190L probably damaging Het
Olfr694 A T 7: 106,689,463 D89E probably benign Het
Pde4b T A 4: 102,430,162 I34N probably damaging Het
Perm1 C A 4: 156,218,673 A558D probably damaging Het
Pgpep1 A G 8: 70,650,615 I203T probably benign Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Prune2 G T 19: 17,121,157 G1342C probably damaging Het
Prune2 G T 19: 17,121,158 G1342V possibly damaging Het
Ros1 T A 10: 52,155,010 I512F possibly damaging Het
Slc10a5 A T 3: 10,335,050 F183L probably damaging Het
Slc13a1 T C 6: 24,137,095 R107G probably damaging Het
Spag5 C T 11: 78,314,182 Q598* probably null Het
Spata6 T A 4: 111,779,279 F256I probably damaging Het
Tnnt1 C A 7: 4,514,334 probably null Het
Top2b T A 14: 16,398,991 L537Q probably damaging Het
Unc79 G A 12: 103,061,388 E413K probably damaging Het
Vmn2r104 A T 17: 20,042,225 F214L probably damaging Het
Zfat T C 15: 68,165,854 N917S probably damaging Het
Zfp317 T C 9: 19,645,254 S53P probably damaging Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55592708 missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55593204 missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55593000 missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55608585 missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55592990 missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55592619 missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55610517 missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55624598 missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55610870 missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55592655 missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55607996 missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55608616 missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55610717 missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55610717 missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55608643 missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55611021 splice site probably benign
R0513:Vmn2r118 UTSW 17 55610970 nonsense probably null
R0627:Vmn2r118 UTSW 17 55610772 missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55608466 missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55608620 missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55593237 nonsense probably null
R1465:Vmn2r118 UTSW 17 55610935 missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55610935 missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55608496 nonsense probably null
R1515:Vmn2r118 UTSW 17 55610643 missense probably benign 0.25
R1550:Vmn2r118 UTSW 17 55608083 missense probably damaging 1.00
R1779:Vmn2r118 UTSW 17 55611530 missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55592456 missense probably damaging 1.00
R1840:Vmn2r118 UTSW 17 55610406 nonsense probably null
R1854:Vmn2r118 UTSW 17 55611556 missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55592882 missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55592925 missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55624650 missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55608421 missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55610347 missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55610665 missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55610860 missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55592581 missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55592894 missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55611565 missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55611565 missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55592765 missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55593103 missense probably benign 0.00
R5927:Vmn2r118 UTSW 17 55624494 missense probably benign 0.04
R6143:Vmn2r118 UTSW 17 55592871 missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55608093 missense probably damaging 1.00
R6760:Vmn2r118 UTSW 17 55592714 missense possibly damaging 0.92
R6794:Vmn2r118 UTSW 17 55592348 missense possibly damaging 0.48
R6929:Vmn2r118 UTSW 17 55610440 missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55608496 nonsense probably null
R7539:Vmn2r118 UTSW 17 55592853 missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55593242 missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55608484 missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55610936 missense probably benign 0.18
R8347:Vmn2r118 UTSW 17 55610423 missense possibly damaging 0.94
R8415:Vmn2r118 UTSW 17 55608057 missense probably benign 0.08
R8428:Vmn2r118 UTSW 17 55608642 missense probably benign 0.33
R8917:Vmn2r118 UTSW 17 55610216 missense possibly damaging 0.82
R8993:Vmn2r118 UTSW 17 55610835 missense possibly damaging 0.72
R9038:Vmn2r118 UTSW 17 55611649 missense probably damaging 1.00
R9155:Vmn2r118 UTSW 17 55610207 missense probably null 0.83
R9603:Vmn2r118 UTSW 17 55592837 missense probably damaging 1.00
R9742:Vmn2r118 UTSW 17 55611009 missense probably damaging 0.98
R9749:Vmn2r118 UTSW 17 55608415 critical splice donor site probably null
R9792:Vmn2r118 UTSW 17 55592496 missense probably damaging 0.99
R9793:Vmn2r118 UTSW 17 55592496 missense probably damaging 0.99
R9795:Vmn2r118 UTSW 17 55592496 missense probably damaging 0.99
X0022:Vmn2r118 UTSW 17 55593218 missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55610655 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTTTGTGTGTCCCAAATAGC -3'
(R):5'- AGAGAGAAATCACTGCTTCCC -3'

Sequencing Primer
(F):5'- CTTTGTGTGTCCCAAATAGCAGAAGC -3'
(R):5'- CCCAAAGGTTGTGACATATCTGGC -3'
Posted On 2018-06-22