Incidental Mutation 'R6574:Ucp1'
ID523355
Institutional Source Beutler Lab
Gene Symbol Ucp1
Ensembl Gene ENSMUSG00000031710
Gene Nameuncoupling protein 1 (mitochondrial, proton carrier)
SynonymsSlc25a7
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_009463.3; MGI: 98894

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6574 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location83290352-83298452 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 83294089 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034146]
Predicted Effect probably null
Transcript: ENSMUST00000034146
SMART Domains Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 5.7e-20 PFAM
Pfam:Mito_carr 109 206 3.3e-20 PFAM
Pfam:Mito_carr 209 300 1.6e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 1857471
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A C 3: 146,650,858 D98E probably benign Het
Ackr3 T C 1: 90,214,068 I83T probably damaging Het
Ahnak A T 19: 9,017,047 M5232L probably benign Het
Ano1 A C 7: 144,607,916 probably null Het
Arap1 T A 7: 101,404,001 I532N probably damaging Het
Armc4 C A 18: 7,129,394 probably null Het
Bsn A G 9: 108,113,954 V1533A possibly damaging Het
Ccdc83 T C 7: 90,226,677 S329G possibly damaging Het
Ccno T A 13: 112,988,185 D96E probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Degs1 T C 1: 182,279,073 Y207C probably damaging Het
Dnah7a A T 1: 53,456,534 probably null Het
Dnah9 C T 11: 66,168,281 A63T probably benign Het
Eif4e1b T C 13: 54,784,898 F100S probably damaging Het
Eps8 A T 6: 137,483,598 Y722* probably null Het
Etfa A T 9: 55,495,626 I96N probably damaging Het
Flt4 A G 11: 49,625,372 T101A probably benign Het
Gabra4 A G 5: 71,623,925 I381T probably benign Het
Gria2 A G 3: 80,689,296 V821A probably damaging Het
Gss G T 2: 155,582,011 T51K probably damaging Het
Igkv13-84 C A 6: 68,939,993 Y91* probably null Het
Iqcb1 A T 16: 36,871,501 Q487H probably damaging Het
Itga8 G A 2: 12,230,161 H429Y probably benign Het
Myo1c T G 11: 75,656,298 probably benign Het
Pcdhga5 T C 18: 37,695,381 L294P probably damaging Het
Pkd2l2 T C 18: 34,425,081 L271P probably damaging Het
Plcb2 T C 2: 118,719,173 D290G probably damaging Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Ppp1r15a T C 7: 45,524,109 D425G probably benign Het
Ppp2r3a G A 9: 101,194,385 P678L probably benign Het
Ptbp2 T G 3: 119,747,947 Q147P probably damaging Het
Sez6l A G 5: 112,576,826 S15P possibly damaging Het
Slc25a10 T C 11: 120,497,077 F199L probably benign Het
Slc4a8 A G 15: 100,807,316 N801S probably damaging Het
Sucnr1 T C 3: 60,086,599 Y183H probably damaging Het
Tcrg-C3 G T 13: 19,261,123 R80S probably benign Het
Tmem67 T C 4: 12,063,086 D520G possibly damaging Het
Trrap G T 5: 144,815,550 probably null Het
Tubgcp5 C T 7: 55,823,583 P803L probably benign Het
Ubash3a A T 17: 31,232,396 Q423L probably damaging Het
Vmn2r94 G T 17: 18,256,159 N425K probably damaging Het
Vps52 A G 17: 33,962,478 M418V probably null Het
Other mutations in Ucp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4585001:Ucp1 UTSW 8 83293948 missense probably damaging 1.00
R0050:Ucp1 UTSW 8 83294228 missense probably damaging 1.00
R0055:Ucp1 UTSW 8 83290604 nonsense probably null
R0055:Ucp1 UTSW 8 83290604 nonsense probably null
R0505:Ucp1 UTSW 8 83295307 missense possibly damaging 0.78
R0590:Ucp1 UTSW 8 83291603 splice site probably benign
R0681:Ucp1 UTSW 8 83295307 missense possibly damaging 0.78
R0731:Ucp1 UTSW 8 83297847 splice site probably benign
R1606:Ucp1 UTSW 8 83295304 missense probably damaging 1.00
R1722:Ucp1 UTSW 8 83290688 missense probably benign 0.25
R1809:Ucp1 UTSW 8 83297867 missense probably damaging 0.99
R1823:Ucp1 UTSW 8 83294032 missense probably damaging 1.00
R3809:Ucp1 UTSW 8 83290641 missense probably damaging 0.99
R4085:Ucp1 UTSW 8 83293951 missense probably benign 0.43
R4673:Ucp1 UTSW 8 83295247 missense probably damaging 1.00
R4998:Ucp1 UTSW 8 83297855 critical splice acceptor site probably null
R5163:Ucp1 UTSW 8 83294203 missense possibly damaging 0.95
R5421:Ucp1 UTSW 8 83290691 missense probably benign 0.12
R5790:Ucp1 UTSW 8 83297891 missense possibly damaging 0.54
R5994:Ucp1 UTSW 8 83293938 missense possibly damaging 0.92
R6732:Ucp1 UTSW 8 83291477 missense probably benign 0.08
R7282:Ucp1 UTSW 8 83293902 missense probably benign 0.03
R7343:Ucp1 UTSW 8 83295252 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAACAAGATCTCAGCCGGC -3'
(R):5'- GGTATAAAATGGGAAGTACCTGCC -3'

Sequencing Primer
(F):5'- AGATCTCAGCCGGCTTAATG -3'
(R):5'- AATGGGAAGTACCTGCCAGTATTTTG -3'
Posted On2018-06-22