Mutagenetix > Incidental Mutations

Incidental Mutation 'R6574:Vps52'

523372

Institutional Source

Beutler Lab

Gene Symbol

Vps52

Ensembl Gene

ENSMUSG00000024319

Gene Name

VPS52 GARP complex subunit

Synonyms

tclw5, ARE1, Sacm2l, D430041K17Rik, tcl-w5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6574 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

33955812-33966984 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33962478 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 418 (M418V)

Ref Sequence

ENSEMBL: ENSMUSP00000133926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025178] [ENSMUST00000173196]

Predicted Effect

probably null
Transcript: ENSMUST00000025178
AA Change: M486V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319
AA Change: M486V

Domain	Start	End	E-Value	Type
low complexity region	1	11	N/A	INTRINSIC
low complexity region	24	45	N/A	INTRINSIC
Pfam:Sec3_C	79	244	4.6e-13	PFAM
Pfam:Vps52	94	601	5.1e-233	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122652

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172558

Predicted Effect

probably null
Transcript: ENSMUST00000173196
AA Change: M418V

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319
AA Change: M418V

Domain	Start	End	E-Value	Type
low complexity region	18	39	N/A	INTRINSIC
Pfam:Vps52	88	120	2.7e-6	PFAM
Pfam:Vps52	116	527	3e-181	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173318

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173445

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174588

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the yeast suppressor of actin mutations 2 gene. The yeast protein forms a subunit of the tetrameric Golgi-associated retrograde protein complex that is involved in vesicle trafficking from from both early and late endosomes, back to the trans-Golgi network. This gene is located on chromosome 6 in a head-to-head orientation with the gene encoding ribosomal protein S18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	A	C	3: 146,650,858	D98E	probably benign	Het
Ackr3	T	C	1: 90,214,068	I83T	probably damaging	Het
Ahnak	A	T	19: 9,017,047	M5232L	probably benign	Het
Ano1	A	C	7: 144,607,916		probably null	Het
Arap1	T	A	7: 101,404,001	I532N	probably damaging	Het
Armc4	C	A	18: 7,129,394		probably null	Het
Bsn	A	G	9: 108,113,954	V1533A	possibly damaging	Het
Ccdc83	T	C	7: 90,226,677	S329G	possibly damaging	Het
Ccno	T	A	13: 112,988,185	D96E	probably benign	Het
Cpsf1	CCCCTGCATGAGGCAGGTCCC	CCCC	15: 76,597,455		probably null	Het
Degs1	T	C	1: 182,279,073	Y207C	probably damaging	Het
Dnah7a	A	T	1: 53,456,534		probably null	Het
Dnah9	C	T	11: 66,168,281	A63T	probably benign	Het
Eif4e1b	T	C	13: 54,784,898	F100S	probably damaging	Het
Eps8	A	T	6: 137,483,598	Y722*	probably null	Het
Etfa	A	T	9: 55,495,626	I96N	probably damaging	Het
Flt4	A	G	11: 49,625,372	T101A	probably benign	Het
Gabra4	A	G	5: 71,623,925	I381T	probably benign	Het
Gria2	A	G	3: 80,689,296	V821A	probably damaging	Het
Gss	G	T	2: 155,582,011	T51K	probably damaging	Het
Igkv13-84	C	A	6: 68,939,993	Y91*	probably null	Het
Iqcb1	A	T	16: 36,871,501	Q487H	probably damaging	Het
Itga8	G	A	2: 12,230,161	H429Y	probably benign	Het
Myo1c	T	G	11: 75,656,298		probably benign	Het
Pcdhga5	T	C	18: 37,695,381	L294P	probably damaging	Het
Pkd2l2	T	C	18: 34,425,081	L271P	probably damaging	Het
Plcb2	T	C	2: 118,719,173	D290G	probably damaging	Het
Pmp22	C	T	11: 63,158,273	A114V	probably damaging	Het
Ppp1r15a	T	C	7: 45,524,109	D425G	probably benign	Het
Ppp2r3a	G	A	9: 101,194,385	P678L	probably benign	Het
Ptbp2	T	G	3: 119,747,947	Q147P	probably damaging	Het
Sez6l	A	G	5: 112,576,826	S15P	possibly damaging	Het
Slc25a10	T	C	11: 120,497,077	F199L	probably benign	Het
Slc4a8	A	G	15: 100,807,316	N801S	probably damaging	Het
Sucnr1	T	C	3: 60,086,599	Y183H	probably damaging	Het
Tcrg-C3	G	T	13: 19,261,123	R80S	probably benign	Het
Tmem67	T	C	4: 12,063,086	D520G	possibly damaging	Het
Trrap	G	T	5: 144,815,550		probably null	Het
Tubgcp5	C	T	7: 55,823,583	P803L	probably benign	Het
Ubash3a	A	T	17: 31,232,396	Q423L	probably damaging	Het
Ucp1	G	A	8: 83,294,089		probably null	Het
Vmn2r94	G	T	17: 18,256,159	N425K	probably damaging	Het

Other mutations in Vps52

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Vps52	APN	17	33956958	missense	possibly damaging	0.96
IGL01098:Vps52	APN	17	33962730	missense	possibly damaging	0.90
IGL01705:Vps52	APN	17	33966068	missense	probably damaging	1.00
IGL01722:Vps52	APN	17	33961615	nonsense	probably null
IGL02992:Vps52	APN	17	33958350	missense	probably damaging	0.97
IGL03279:Vps52	APN	17	33957874	missense	probably damaging	0.96
R0363:Vps52	UTSW	17	33962117	missense	probably benign	0.26
R0762:Vps52	UTSW	17	33960011	missense	probably damaging	1.00
R1065:Vps52	UTSW	17	33961239	missense	probably benign	0.02
R1506:Vps52	UTSW	17	33957894	missense	probably damaging	1.00
R3760:Vps52	UTSW	17	33960188	missense	possibly damaging	0.64
R4714:Vps52	UTSW	17	33961179	missense	probably benign	0.25
R5381:Vps52	UTSW	17	33958301	missense	possibly damaging	0.77
R5590:Vps52	UTSW	17	33961221	missense	probably benign	0.01
R5928:Vps52	UTSW	17	33961126	missense	possibly damaging	0.85
R6003:Vps52	UTSW	17	33956094	start codon destroyed	probably null	0.01
R6302:Vps52	UTSW	17	33963215	missense	probably damaging	1.00
R6695:Vps52	UTSW	17	33963199	nonsense	probably null
R6888:Vps52	UTSW	17	33963206	missense	probably benign	0.06
R7022:Vps52	UTSW	17	33959319	missense	probably benign	0.04
R7136:Vps52	UTSW	17	33965288	missense	probably benign	0.00
R7380:Vps52	UTSW	17	33958309	missense	possibly damaging	0.82
R7727:Vps52	UTSW	17	33962134	missense	probably benign	0.21
R7888:Vps52	UTSW	17	33965751	missense	probably damaging	0.98
R7971:Vps52	UTSW	17	33965751	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCCCATTCATGTGTCCCAGG -3'
(R):5'- ACTGGGAGATACAACCCTCAG -3'

Sequencing Primer
(F):5'- ATTCATGTGTCCCAGGGGCAG -3'
(R):5'- GCAAGTTCTGTCACCAGTCAG -3'

Posted On

2018-06-22