Incidental Mutation 'R6574:Vps52'
ID523372
Institutional Source Beutler Lab
Gene Symbol Vps52
Ensembl Gene ENSMUSG00000024319
Gene NameVPS52 GARP complex subunit
Synonymstclw5, ARE1, Sacm2l, D430041K17Rik, tcl-w5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6574 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33955812-33966984 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33962478 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 418 (M418V)
Ref Sequence ENSEMBL: ENSMUSP00000133926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025178] [ENSMUST00000173196]
Predicted Effect probably null
Transcript: ENSMUST00000025178
AA Change: M486V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319
AA Change: M486V

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
low complexity region 24 45 N/A INTRINSIC
Pfam:Sec3_C 79 244 4.6e-13 PFAM
Pfam:Vps52 94 601 5.1e-233 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172558
Predicted Effect probably null
Transcript: ENSMUST00000173196
AA Change: M418V

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319
AA Change: M418V

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:Vps52 88 120 2.7e-6 PFAM
Pfam:Vps52 116 527 3e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174588
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the yeast suppressor of actin mutations 2 gene. The yeast protein forms a subunit of the tetrameric Golgi-associated retrograde protein complex that is involved in vesicle trafficking from from both early and late endosomes, back to the trans-Golgi network. This gene is located on chromosome 6 in a head-to-head orientation with the gene encoding ribosomal protein S18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik A C 3: 146,650,858 D98E probably benign Het
Ackr3 T C 1: 90,214,068 I83T probably damaging Het
Ahnak A T 19: 9,017,047 M5232L probably benign Het
Ano1 A C 7: 144,607,916 probably null Het
Arap1 T A 7: 101,404,001 I532N probably damaging Het
Armc4 C A 18: 7,129,394 probably null Het
Bsn A G 9: 108,113,954 V1533A possibly damaging Het
Ccdc83 T C 7: 90,226,677 S329G possibly damaging Het
Ccno T A 13: 112,988,185 D96E probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Degs1 T C 1: 182,279,073 Y207C probably damaging Het
Dnah7a A T 1: 53,456,534 probably null Het
Dnah9 C T 11: 66,168,281 A63T probably benign Het
Eif4e1b T C 13: 54,784,898 F100S probably damaging Het
Eps8 A T 6: 137,483,598 Y722* probably null Het
Etfa A T 9: 55,495,626 I96N probably damaging Het
Flt4 A G 11: 49,625,372 T101A probably benign Het
Gabra4 A G 5: 71,623,925 I381T probably benign Het
Gria2 A G 3: 80,689,296 V821A probably damaging Het
Gss G T 2: 155,582,011 T51K probably damaging Het
Igkv13-84 C A 6: 68,939,993 Y91* probably null Het
Iqcb1 A T 16: 36,871,501 Q487H probably damaging Het
Itga8 G A 2: 12,230,161 H429Y probably benign Het
Myo1c T G 11: 75,656,298 probably benign Het
Pcdhga5 T C 18: 37,695,381 L294P probably damaging Het
Pkd2l2 T C 18: 34,425,081 L271P probably damaging Het
Plcb2 T C 2: 118,719,173 D290G probably damaging Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Ppp1r15a T C 7: 45,524,109 D425G probably benign Het
Ppp2r3a G A 9: 101,194,385 P678L probably benign Het
Ptbp2 T G 3: 119,747,947 Q147P probably damaging Het
Sez6l A G 5: 112,576,826 S15P possibly damaging Het
Slc25a10 T C 11: 120,497,077 F199L probably benign Het
Slc4a8 A G 15: 100,807,316 N801S probably damaging Het
Sucnr1 T C 3: 60,086,599 Y183H probably damaging Het
Tcrg-C3 G T 13: 19,261,123 R80S probably benign Het
Tmem67 T C 4: 12,063,086 D520G possibly damaging Het
Trrap G T 5: 144,815,550 probably null Het
Tubgcp5 C T 7: 55,823,583 P803L probably benign Het
Ubash3a A T 17: 31,232,396 Q423L probably damaging Het
Ucp1 G A 8: 83,294,089 probably null Het
Vmn2r94 G T 17: 18,256,159 N425K probably damaging Het
Other mutations in Vps52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Vps52 APN 17 33956958 missense possibly damaging 0.96
IGL01098:Vps52 APN 17 33962730 missense possibly damaging 0.90
IGL01705:Vps52 APN 17 33966068 missense probably damaging 1.00
IGL01722:Vps52 APN 17 33961615 nonsense probably null
IGL02992:Vps52 APN 17 33958350 missense probably damaging 0.97
IGL03279:Vps52 APN 17 33957874 missense probably damaging 0.96
R0363:Vps52 UTSW 17 33962117 missense probably benign 0.26
R0762:Vps52 UTSW 17 33960011 missense probably damaging 1.00
R1065:Vps52 UTSW 17 33961239 missense probably benign 0.02
R1506:Vps52 UTSW 17 33957894 missense probably damaging 1.00
R3760:Vps52 UTSW 17 33960188 missense possibly damaging 0.64
R4714:Vps52 UTSW 17 33961179 missense probably benign 0.25
R5381:Vps52 UTSW 17 33958301 missense possibly damaging 0.77
R5590:Vps52 UTSW 17 33961221 missense probably benign 0.01
R5928:Vps52 UTSW 17 33961126 missense possibly damaging 0.85
R6003:Vps52 UTSW 17 33956094 start codon destroyed probably null 0.01
R6302:Vps52 UTSW 17 33963215 missense probably damaging 1.00
R6695:Vps52 UTSW 17 33963199 nonsense probably null
R6888:Vps52 UTSW 17 33963206 missense probably benign 0.06
R7022:Vps52 UTSW 17 33959319 missense probably benign 0.04
R7136:Vps52 UTSW 17 33965288 missense probably benign 0.00
R7380:Vps52 UTSW 17 33958309 missense possibly damaging 0.82
R7727:Vps52 UTSW 17 33962134 missense probably benign 0.21
R7888:Vps52 UTSW 17 33965751 missense probably damaging 0.98
R7971:Vps52 UTSW 17 33965751 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCATTCATGTGTCCCAGG -3'
(R):5'- ACTGGGAGATACAACCCTCAG -3'

Sequencing Primer
(F):5'- ATTCATGTGTCCCAGGGGCAG -3'
(R):5'- GCAAGTTCTGTCACCAGTCAG -3'
Posted On2018-06-22