Incidental Mutation 'R6575:Lbr'
ID523377
Institutional Source Beutler Lab
Gene Symbol Lbr
Ensembl Gene ENSMUSG00000004880
Gene Namelamin B receptor
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_133815.2; Ensembl: ENSMUST00000005003

Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R6575 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location181815335-181843046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181836198 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 86 (S86P)
Ref Sequence ENSEMBL: ENSMUSP00000005003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005003] [ENSMUST00000191878] [ENSMUST00000193028] [ENSMUST00000193030] [ENSMUST00000195299]
Predicted Effect probably damaging
Transcript: ENSMUST00000005003
AA Change: S86P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005003
Gene: ENSMUSG00000004880
AA Change: S86P

DomainStartEndE-ValueType
TUDOR 4 62 6.7e-9 SMART
low complexity region 63 101 N/A INTRINSIC
low complexity region 111 121 N/A INTRINSIC
Pfam:ERG4_ERG24 194 626 4.6e-161 PFAM
Pfam:DUF1295 452 617 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158804
Predicted Effect unknown
Transcript: ENSMUST00000191878
AA Change: S86P
SMART Domains Protein: ENSMUSP00000142133
Gene: ENSMUSG00000004880
AA Change: S86P

DomainStartEndE-ValueType
TUDOR 4 62 4.1e-11 SMART
low complexity region 63 101 N/A INTRINSIC
low complexity region 111 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193028
Predicted Effect possibly damaging
Transcript: ENSMUST00000193030
AA Change: S86P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141335
Gene: ENSMUSG00000004880
AA Change: S86P

DomainStartEndE-ValueType
TUDOR 4 62 4.1e-11 SMART
low complexity region 63 101 N/A INTRINSIC
low complexity region 111 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195299
SMART Domains Protein: ENSMUSP00000142167
Gene: ENSMUSG00000004880

DomainStartEndE-ValueType
TUDOR 4 62 4.1e-11 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ERG4/ERG24 family. It localized in the nuclear envelope inner membrane and anchors the lamina and the heterochromatin to the membrane. It may mediate interaction between chromatin and lamin B. Mutations of this gene has been associated with autosomal recessive HEM/Greenberg skeletal dysplasia. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in abnormal skin and hair and impair growth. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(17) Spontaneous(6)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,182,817 Y1177C probably damaging Het
4933402N22Rik A T 5: 11,920,645 K62* probably null Het
Acnat1 A G 4: 49,450,785 Y109H possibly damaging Het
Adgrf3 T A 5: 30,196,524 K835N possibly damaging Het
Afg1l T C 10: 42,318,716 D360G probably damaging Het
Ap3s1 C T 18: 46,754,381 T27M probably benign Het
Atp8b4 A G 2: 126,414,364 L225P probably damaging Het
Bicra G A 7: 15,979,131 T997I probably benign Het
Bod1l T C 5: 41,838,068 R112G probably damaging Het
Cabin1 T C 10: 75,725,701 T989A possibly damaging Het
Cog1 C A 11: 113,656,061 Q494K probably benign Het
Cyb5rl T C 4: 107,085,353 Y160H probably benign Het
Dnajb8 A G 6: 88,223,075 N198D probably damaging Het
Eif3l C A 15: 79,086,578 Q351K possibly damaging Het
Esr1 T C 10: 4,966,301 probably benign Het
Fam3c G T 6: 22,329,608 A40D probably damaging Het
Fcrla A G 1: 170,922,228 S87P probably damaging Het
Glra1 A G 11: 55,520,996 Y246H probably damaging Het
Gm2056 T C 12: 88,027,347 I115T probably damaging Het
Gm45871 T A 18: 90,591,720 C361S probably damaging Het
Greb1l A G 18: 10,547,347 N1522D possibly damaging Het
Hcn4 T C 9: 58,824,152 M214T unknown Het
Heatr5b A T 17: 78,762,989 V1665E probably damaging Het
Hemgn C A 4: 46,395,990 M415I possibly damaging Het
Hibadh G A 6: 52,547,028 T295I probably damaging Het
Iars T C 13: 49,725,269 L947P probably damaging Het
Icam2 G A 11: 106,378,759 T178I probably damaging Het
Lipe G A 7: 25,383,324 T801I probably benign Het
Lrp6 T C 6: 134,541,971 T44A possibly damaging Het
Malrd1 A G 2: 15,842,628 H1193R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myh10 A G 11: 68,808,850 I1671V probably benign Het
Olfr15 A G 16: 3,839,030 D19G probably benign Het
Osbpl9 T C 4: 109,072,932 D334G possibly damaging Het
Pdcd11 A G 19: 47,109,678 D801G probably damaging Het
Pfdn4 C A 2: 170,516,636 D16E probably benign Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Rrp9 C T 9: 106,483,579 T253I probably damaging Het
Tcrg-V4 T A 13: 19,185,080 C34S probably benign Het
Tnrc6a A G 7: 123,169,910 T308A probably damaging Het
Trhr A G 15: 44,229,206 M280V possibly damaging Het
Trp53bp1 G A 2: 121,228,603 H926Y probably damaging Het
Trpv5 A T 6: 41,675,969 I90K probably benign Het
Ttn T C 2: 76,888,915 probably benign Het
Vav1 A C 17: 57,305,280 R513S probably damaging Het
Vmn2r100 A T 17: 19,521,409 T128S probably benign Het
Zfp687 T C 3: 95,008,389 Y1024C probably damaging Het
Zfp938 C A 10: 82,225,326 G487* probably null Het
Znrf2 A G 6: 54,878,445 Y73C probably damaging Het
Other mutations in Lbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Lbr APN 1 181825643 nonsense probably null
IGL01680:Lbr APN 1 181836194 missense probably damaging 1.00
IGL02738:Lbr APN 1 181832213 missense probably benign 0.16
IGL03048:Lbr APN 1 181838544 utr 5 prime probably benign
IGL03227:Lbr APN 1 181836055 unclassified probably null
IGL03337:Lbr APN 1 181832223 missense possibly damaging 0.92
Aconcagua UTSW 1 181828902 missense probably benign 0.02
kosciuszko UTSW 1 181825621 critical splice donor site probably null
Mont_blanc UTSW 1 181820702 missense probably damaging 1.00
seven UTSW 1 181832213 missense probably benign 0.16
1mM(1):Lbr UTSW 1 181831679 missense possibly damaging 0.65
H8562:Lbr UTSW 1 181820668 splice site probably benign
IGL02991:Lbr UTSW 1 181821552 missense probably damaging 1.00
R0597:Lbr UTSW 1 181832213 missense probably benign 0.16
R1118:Lbr UTSW 1 181820668 splice site probably benign
R1727:Lbr UTSW 1 181819916 missense probably benign 0.01
R2566:Lbr UTSW 1 181836127 missense probably damaging 0.96
R3699:Lbr UTSW 1 181818920 missense probably damaging 1.00
R3854:Lbr UTSW 1 181831715 missense probably benign 0.05
R4290:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4292:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4293:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4294:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4295:Lbr UTSW 1 181820702 missense probably damaging 1.00
R4771:Lbr UTSW 1 181838421 missense probably damaging 1.00
R4890:Lbr UTSW 1 181817568 missense probably benign 0.10
R5011:Lbr UTSW 1 181819888 nonsense probably null
R5402:Lbr UTSW 1 181819961 missense probably benign 0.00
R5486:Lbr UTSW 1 181818838 critical splice donor site probably null
R5617:Lbr UTSW 1 181828902 missense probably benign 0.02
R5630:Lbr UTSW 1 181816964 unclassified probably null
R6360:Lbr UTSW 1 181832155 missense probably benign 0.00
R7069:Lbr UTSW 1 181828789 missense probably damaging 1.00
R7342:Lbr UTSW 1 181825621 critical splice donor site probably null
R7590:Lbr UTSW 1 181821511 missense probably damaging 1.00
R7686:Lbr UTSW 1 181817521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGCATTTGTATAGGGAAGC -3'
(R):5'- CTGTTGTAGCATCACACTGTG -3'

Sequencing Primer
(F):5'- CATTTGTATAGGGAAGCCGGCG -3'
(R):5'- TTCTCAGAGCCATGAGTGTAGAATGC -3'
Posted On2018-06-22